Observation 188072: Mycena epipterygia group
When: 2014-11-11
Collection location: Washington, USA [Click for map]
No herbarium specimen

Images

480712
1.JPG
480713
P1180999.JPG
480714
P1190006.JPG
480715
P1190008.JPG
480716
P1190009.JPG
480717
P1190011.JPG

Proposed Names

29% (1)
Eye3
Recognized by sight
28% (3)
Recognized by sight
85% (1)
Eyes3
Recognized by sight: This is the North American / Northern European species, which is different from the M. epiptergyria described from Slovenia

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS Sequence / phylogenetic tree
By: Alan Rockefeller (Alan Rockefeller)
2015-01-07 23:24:28 CET (+0100)

ITS sequence: TGCGGAAGGATCATTATTGAATACGTTGGTACTGTTGCTGGCTCTTCACTGAGCATGTGCACGTCCATCTATTTATCTTCTCTTGTGCACCTTTTGTAGTCTTTTTCTGAAAAAGAGCGAGCAGAGGGCATTTATCCGCCGGTGGCTGCCCCTGGAGTTTAGTAACTTGTTACTTGGCCAGGGGTTTGGGGCTTGATCCCAGAAACCACCGGAGGGCAATCTGCTTTTGCTCTTTTCCAGAGGGGCTACGTTTTCATATACACTATTAAAGTTACAGAATGTCTTTTAAAGACTGTGCTAGCCGCAGTCATTAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTTTTGCTTTGCTTGCGAAGTATCTAGGCTTGGATGTGGGGGTTTTTGCTGGCTTCCTTCAGTGGATGGTCTGCTCCCCTTAAATGCATTAGCGGGATCTCTTGTGGACCGTCACTTGGTGTGATAATTATCTATACCACTTGGCCTTGAAGCAAATCTTATGAGGACCCGCTCATAACCGTCCCTCTGGGACAACTCTTGACATTTTGACCTCAAATCANGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTCTGTGGCCGTCCGAGTTGTAATTTAGAGAAGTGTTATCCGCGCTGGAC

Phylogenetic tree:

There are at least two species going under the name Mycena epipterygia. This collection is in a group that includes both North America and Northern Europe collections, the other group is only in Southern Europe. Since the type collection was made in 1772 in Carniola, this is probably the undescribed North American species.

Carniola is now mostly in Slovenia, but a small part is in Italy.

Created: 2014-11-11 20:23:55 CET (+0100)
Last modified: 2015-01-08 07:50:08 CET (+0100)
Viewed: 131 times, last viewed: 2016-10-24 03:57:20 CEST (+0200)
Show Log