Observation 188496: Cortinarius elegantior group
When: 2014-11-12

Notes: Growing semi-buried near mixed woods @ ~ 4250 ft.
Caps up to 11.2 cm across.
Spores ~ 12.8 X 14.1 X 7.8-9.0 microns, ellipsoid and quite verrucose.
KOH on the cap was red and on the other surfaces, a lighter reddish color.
These were very meaty and initially thought they were C. ponderosus until I saw the rather large bulbs. The spores are also larger.

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Many thanks to Alan & Dimitar.
By: Ron Pastorino (Ronpast)
2016-05-08 10:49:13 CDT (-0400)
Another tree
By: Alan Rockefeller (Alan Rockefeller)
2016-05-08 01:57:11 CDT (-0400)

Dimitar put this sequence into his tree and found that it matches well with the California version of C. elegantior.

It does look…
By: I. G. Safonov (IGSafonov)
2016-05-05 20:09:14 CDT (-0400)

…very much like the European parafulmineus!

A better tree
By: Alan Rockefeller (Alan Rockefeller)
2016-05-05 18:27:04 CDT (-0400)

http://50.31.154.67/cortinarius-ron-pastorino-tree.jpg

This one has less noise and includes locations if the location field was filled in on the GenBank record.

Thanks Alan,
By: Ron Pastorino (Ronpast)
2016-05-04 21:21:41 CDT (-0400)

and it does seem to fit the general description of Cortinarius elegantior var americanus, which was described from Wyoming by Moser et. al. in 1995.
I think the tree seems to indicate it is at least in the same neighborhood as C. elegantior from Europe.

Here’s a tree
By: Alan Rockefeller (Alan Rockefeller)
2016-05-04 21:03:12 CDT (-0400)

I made it by downloading the 100 closest BLAST matches, adding the sequence of Ron’s cort and uploading the FASTA to phylogeny.lirmm.fr, then adding an arrow using The Gimp. To make it an even more useful tree what needs to be done is to add in the locations for each of the sequences in the name field of the FASTA. This is a very tedious process, and I am going to work on some code today to automate it.

Dimitar probably has a curated FASTA which would give even better results.

http://50.31.154.67/cort-tree-pastorino.jpg

Let me guess..
By: Dimitar Bojantchev (dimitar)
2016-05-04 20:25:00 CDT (-0400)

This is either in the C. elegantior group, or another species that we named recently… will look when I get back home.

Thanks again Alan,
By: Ron Pastorino (Ronpast)
2016-05-04 19:11:29 CDT (-0400)

I need to figure out how to make a decent tree to see what the closest relatives are. Also, I’ll humbly accept any help in achieving that end.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-04 15:05:50 CDT (-0400)

Sequencing this was complicated by the homopolymeric long string of T’s, which causes slippage of the TAQ polymerase enzyme. By carefully comparing the chromatograms of the forward and reverse strands with the close GenBank matches I was able to get a good sequence. I notice that the other close sequences in GenBank all had the same problem, enzyme slippage in repeat regions is an inherent limitation of Sanger sequencing. When comparing this sequence to others, any sequence differences next to the TTTTTTT should be considered to be artifacts, and the exact number of T’s are unknowable using this technology. Differences anywhere else in the sequence are real.

CCTGATAGTTGTTGCTGGTTCTCTAGGGAGCATGTGCACACTTGTCATCTTTGTATCTCCACCTGTGCAC
CTTTTGTAGACCTTGGGTATCTCTCTGATTGCTTTAGCAACTCAGGATTGAGGATTGACTTTCTGTCTCT
TCTTACATTTCCAGGCCTATGTTTTTCAAATACCCTAATGTATGTTTATAGAATGTAATCAAGTAGGCCT
TTGTGCCTATAAATTGATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCG
AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCT
TGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAATATATCAACCTTTTTTTGGTTGGATGTGGGTT
TGCTGGCCGCTTTGGAGGTCAGCTCCCCTTAAATGCATTAGCAGACAATATTTTGCCAAACGTTTCATTG
GTGTGATAATTATCTACGCTATTGACGTGAAGTAAAGGTTCAGCTTCTAACAGTCCATTGACTTGGACAA
TTTTATTTATTAATGTGACCTCAAATCA

Cool
By: Christian (Christian Schwarz)
2014-11-14 17:11:26 CST (-0500)

I don’t think C. ponderosus has a marginate bulb either

Created: 2014-11-14 17:02:43 CST (-0500)
Last modified: 2016-05-08 10:16:35 CDT (-0400)
Viewed: 275 times, last viewed: 2016-10-29 19:33:28 CDT (-0400)
Show Log