Observation 188944: Copelandia Bres.
When: 2014-06-24
Collection location: Gahanna, Ohio, USA [Click for map]

Notes: Growing on grass near bike path. Bruised blue.

Proposed Names

28% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-26 05:22:29 CEST (+0200)

GGTAGACGCTGTTGCTGTCCCTCTCGGGGGAATCTTGTGCACGCATCTGCCTTTTTTGTTTATCCACCTG
TGCATACACTGTAGGTCTGGGGGAAGTCTTGTAAGGGAGGTAACTCTCTGAAGGGCTTCATTCATTCCCA
GGTCCTATGTATTTTTACATATACACTATAGAAAGTAACAGAACGAATCAATGGGCATTAGCCTATAAAC
TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGT
AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACG
AGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCACTTTTGTGATGATGGCTTGGATGTGGAGG
TTTTCTGCAGGCTGTCAAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTAT
TGGTGTGATAATTATCTACGCCGTGGGTTTAAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACTG
TCCTGTTATTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA
TCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAA
ATTTAAAATCTGGCAGTCTCTGATTGTCCGAGTTGTAATCTAGAGAAGCATTATCCGCGCTGGACCGTGT
C

Created: 2014-11-19 03:24:22 CET (+0100)
Last modified: 2016-12-03 09:27:38 CET (+0100)
Viewed: 31 times, last viewed: 2017-06-19 15:36:12 CEST (+0200)
Show Log