Observation 188944: Copelandia Bres.
When: 2014-06-24
Collection location: Gahanna, Ohio, USA [Click for map]

Notes: Growing on grass near bike path. Bruised blue.

Proposed Names

28% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-25 22:22:29 CDT (-0500)

GGTAGACGCTGTTGCTGTCCCTCTCGGGGGAATCTTGTGCACGCATCTGCCTTTTTTGTTTATCCACCTG
TGCATACACTGTAGGTCTGGGGGAAGTCTTGTAAGGGAGGTAACTCTCTGAAGGGCTTCATTCATTCCCA
GGTCCTATGTATTTTTACATATACACTATAGAAAGTAACAGAACGAATCAATGGGCATTAGCCTATAAAC
TATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGT
AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCGTTGGTATTCCGACG
AGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATCACTTTTGTGATGATGGCTTGGATGTGGAGG
TTTTCTGCAGGCTGTCAAAAGTCTGCTCCTCTCAAATGAATTAGTGGGTGCCCCGCGCAAACCTATCTAT
TGGTGTGATAATTATCTACGCCGTGGGTTTAAGGATTGCTGTAAAAAGGTGTTTGCCCTGCTTCTAACTG
TCCTGTTATTGGGACAACTTGAACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATA
TCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAA
ATTTAAAATCTGGCAGTCTCTGATTGTCCGAGTTGTAATCTAGAGAAGCATTATCCGCGCTGGACCGTGT
C

Created: 2014-11-18 20:24:22 CST (-0600)
Last modified: 2016-12-03 02:27:38 CST (-0600)
Viewed: 30 times, last viewed: 2016-12-03 02:27:39 CST (-0600)
Show Log