Observation 189490: Amanita virosiformis (Murrill) Murrill
When: 2014-09-07
No herbarium specimen
0 Sequences

Notes:
The Top BLAST match was Amanita cf. virosa Montoya (sequence size was 245, 84% max identity):

GAGTAGCATCGTAGGTGACCTGCGGAGGATCATTATTAGAAAACCAAAAAGGGCTTTGGG
CCTGTTCCGGGGGGTTTTTTTTTAGGCACATGTGCCCGTCTCTTGCTTATTTGAAAAAAA
TTTCCACCTGTGCATGATGTGTAGATTGCCTAGGATTTGAGCAACAAGAATTTTTTTTGT
CTTTTGTTTTTACTAAACTCAAGCGGGCTTTTTTTTTTTTCTATTACACTTACCGAGAAA
GAAAG
"

Habitat- sandy soil, oak and pine woods
Spore print- whitish cream
Spores- 11.62-15.77×4.15-4.98 microns
Pileus-3.35-5.5cm
Stipe- 6.0-9.0×1.0cm

Proposed Names

54% (1)
Eye3 Eyes3
Used references: http://www.amanitaceae.org?Amanita%20virosiformis
http://www.amanitaceae.org/?Amanita+cylindrispora
http://www.mushroomexpert.com/amanita.html
Mushrooms of the Midwest (M. Kuo & A. Methven):
North American Mushrooms a Field Guide To Edible and Inedible Fungi (O. & H. Miller)
Based on microscopic features

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Thanks, Steve.
By: R. E. Tulloss (ret)
2017-01-06 12:30:54 EST (-0500)

If I remember correctly, Cristina started it as a spreadsheet after a discussion between us about getting more out of the nrITS data. As you probably can tell, the last update of the page was by Naomi, who went back to the spreadsheet mode and then updated the page. The page is now, again, out of date because it doesn’t show the correct plenitude of Vaginatae with the 28S 5’ motif TCTGACCTCAAATCA. That is a fascinating group with very broad distribution in the world. A lot of species in the group came to my attention through MO. Another contribution of the MO collectors to the Amanita data mavens.

Very best,

Rod

Thanks Rod.
By: Stephen Russell (Mycota)
2017-01-06 12:09:23 EST (-0500)

That is a pretty stellar page.

Readers might be interested in a partial catalog of locus termini…
By: R. E. Tulloss (ret)
2017-01-06 10:34:39 EST (-0500)
My original comment of today reappeared…
By: R. E. Tulloss (ret)
2017-01-06 10:30:25 EST (-0500)

so I zapped it to avoid confursion.

Rod

My comment seems to have been destroyed accidentally.
By: R. E. Tulloss (ret)
2017-01-06 10:29:06 EST (-0500)

I agree with Steve. The sequence looks like an initial segment of nrITS, but there is a minor problem and more significant problems that can be seen even without an alignment.

There is a small flaw in the fragment of 18S that is often the result of using only a forward read to try for an nrITS sequence. The 5’ (right hand end) motif of 18S should terminate with …GGAAGGATCATTA. What you have is missing one of the first pair of A’s in the motif. This is often missed by a forward read because it is too near the beginning of the read. A reverse read will usually pick it up correctly if the sequence is relatively clean.

Following GGATCATTA, you have “TTAG” It is very unusual for the beginning of ITS1 not to have a “G” in the third position. So without alignment there may be something fishy here.

Also, the beginning of ITS1 is often related to the section of the genus that is represented by your sample. In section Phalloideae, the most common left hand terminal characters are “ATG…” and “CTG….” We know of only one with “TTG” (and this is east Asian material). So, again, just by examination of the sequence, it would be a good idea to have a “do over.”

Very best,

Rod

The sequence here is suspect. I have the specimen
By: Stephen Russell (Mycota)
2017-01-05 22:43:44 EST (-0500)

and am going to run it again.

Good evening, Kat. … EDITed
By: R. E. Tulloss (ret)
2014-12-28 23:02:48 EST (-0500)

In the technical descriptions on www.amanitaceae.org, the order of description of the elements of the stipe is (1) stipe description above the bulb excluding veils, (2) bulb excluding universal veil, (3) context, (4) partial veil, (5) universal veil.

This is the standard approach that I’ve developed and used over the last 36 (roughly) years. It’s a divide and conquer approach, set up so that comparisons between species are easier for a reader to make.

Except for item (1), the descriptions of parts begin with the name of the relevant part in italic type. The idea is to help the reader find the start of the description of a specific part in a long overall description of the stipe.

The data you were looking for is here:

…; universal veil as membranous to submembranous, limbate volva, torn into irregular lobes, smooth surfaced or impregnated with sand, white with occasional reddish or reddish brown stains, sometimes a pinkish tint on the interior surface, rarely(?) “bruising pinkish” (Murrill, regarding F17658), thin (less than 1 mm thick), upstanding at first and separated from the stipe barely (often with no evidence of limbus internus) or (less often) by width of complete, or rounded remnant of, limbus internus, adnate for about half to two-thirds of limb height, not clearly having an internal layer; height from highest tip of limb to bottom of bulb 33 – 62 mm (Beardslee: free limb 20 – 40 mm long).

The upshot is that there is a very pronounced, upstanding volval limb present in cylindrispora.

Unfortunately, your problem is not yet resolved.

Very best,

Rod

Update
By: katwerner89
2014-12-28 21:17:06 EST (-0500)

I keyed Amanita cylindrispora backwards on mushroomexpert.com and found I that it did not match mine because in the key leading up to A. cylindrispora I would have to choose “Stem base without a sack-like volva” and mine does have a sac-like volva. The description on http://www.amanitaceae.org/?Amanita%20cylindrispora does not say that directly it says “bulb 23 – 34 × 13 – 23 mm (Beardslee: bulb 50 – 70 mm long), rounded below (subclavate) to napiform to very slenderly fusiform to subfusiform, subradicating to radicating, occasionally doglegged, with white mycelium at base”. I guess you really have to know your terminology for this one! But hey, I learned something new!

I’m not sure whether you will get a reaction to KOH from dried material.
By: R. E. Tulloss (ret)
2014-11-26 09:19:37 EST (-0500)

I’ll try contacting you through MO’s email function. If you’d like to lay out what you know and what your problems are, I’m interested in helping you solve this one.

Very best,

Rod

This a toughy…
By: katwerner89
2014-11-25 23:58:44 EST (-0500)

Yes, the soil is pretty sandy. It in my yard which is next to a wooded sand dune (mainly oak, pine and sassafras).

I’ll have to try the KOH next week but, would it still react the same on a dried specimen?

A.cylindrispora or A. virosiformis sound the most likely, but some things just don’t line up. I dont know but this one is sure giving me a lot of trouble!

It’s rather unusual to find any of the things I’ve suggested in Indiana.
By: R. E. Tulloss (ret)
2014-11-25 15:12:43 EST (-0500)

It looks like the mushroom was in dark sand. I see that you’re not very distant from a lake shore area.

Did you try a drop of KOH on the cap?

Very best,

Rod

Looks like 2/3 of the stipe was in the soil.
By: R. E. Tulloss (ret)
2014-11-25 15:06:50 EST (-0500)

Is that correct?

If so, try

http://www.amanitaceae.org?Amanita%20cylindrispora

in section Lepidella.

Very best,

rod

It’s either in section Phalloideae or is …
By: R. E. Tulloss (ret)
2014-11-25 14:57:35 EST (-0500)

one of the limbate species in section Lepidella.

The extremely narrow spores are the clue.

For links to descriptions for the latter:

http://www.amanitaceae.org?subsection%20Limbatulae

For the former, try

http://www.amanitaceae.org?Amanita%20virosiformis

(and my apologies for the crumby picture…I’ve only found the species once).

Let me know how it goes.

Very best,

Rod

Created: 2014-11-25 13:58:05 EST (-0500)
Last modified: 2014-12-28 20:32:20 EST (-0500)
Viewed: 171 times, last viewed: 2017-09-28 16:12:22 EDT (-0400)
Show Log