Observation 190658: Hygrocybe conica (Schaeff.) P. Kumm.
When: 2014-11-19

Notes: untrimmed ITS Sequence from a collection made from the same mycelium
NNNNNNNNNNNNNNCNNNTTNAGGTGANA
TTGTCAGAGGANAGGTGAGGAGGCACAAAG
GCACCTCTCCACGCCATCAGTTGTGAGCGAG
CAAAGCTTTCCACAGCTGCAAAACCCACCC
CTAGCATGAAGATACTATCAATGCCAGAGA
AGCGCGGTGCATGCGGATGTCACATCGCTA
ATGCATTTTAGAGGAGCTGGGCTTCATTGAC
AAAAGGCCAGCACACCCCAATTCCAAAAGAG
AAACGGTCAAGCTTCCCTTTTGAGGATTCA
ACGACACTCAAACAGGCATGCCCCTCGGAA
TACCAAGAGGCGCAAGGTGCGTTCAAAGAT
TCGATGATTCACGGAATTCTGCAATTCACAT
TACGTATCGCATTTCGCTGCGTTCTTCATCG
ATGCGAGAGCCAAGAGATCCATTGTTGAAAG
TTGTTTCTGTGATTACTTTTTTTACAAATAAT
CCATAAGATGCATTCAAGAGCACCATTCAAA
AAGTGTGAGATGAGGGAATACATAGGACGCC
CAGACCAATGAAGGTGAGTGGACGCCTACAA
GATGTGCACAAGGGTGTGATGGAAATTTTGA
ATTGTTCAAGGAGTGCACATTGCCTCTGAGA
AGAGGCCAGCAACATCCCCAAATCACTTCAG
TAATGATCCTTCCGCANGTTCACCTACGGAAA
CCTTGTTACGACTTTTACTTCCTCTAAATGACCAAGA

Proposed Names

28% (1)
Eye3 Eyes3
Recognized by sight: in grass, blackening orange and red waxy cap, perhaps European import?

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-11-30 15:06:09 CST (-0500)
Last modified: 2014-11-30 15:06:20 CST (-0500)
Viewed: 8 times, last viewed: 2015-03-09 20:03:21 CDT (-0400)
Show Log