Observation 192409: Melanoleuca Pat.
When: 2014-12-08
(37.8679° 122.2752° 45m)

Notes: In wood chipped garden. Two fruitbodies found. Caps were a few cm across with a slight umbo.

Pleurocystidia were not found, but abundant cheilocystidia had a fat base with a long narrow neck with fine linear crystals at the apex. Spores were 6.2-7.0 X 4.1-4.7 with amyloid warts. The warts were absent around the hilar appendage and made a distinct ring around it.

Microscopic and macroscopic features fit the description in Funga Nordica fairly well, but being a continent away this may be a different but related species. The garden setting, however, may mean that its not a native here.

Images

490322
490324
490325
490326
spores in meltzers
490327
spores in meltzers note the circles of warts around hilar appendage
490328

Proposed Names

28% (1)
Used references: Funga Nordica
Based on microscopic features: cheilocystidia with narrow septate ends, spore size and ornamentation
91% (2)
Eye3 Eyes3
Based on chemical features: Sequence says its not microcephalia

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Here is the ITS sequence – BLAST away
By: Tom Bruns (pogon)
2015-01-30 17:47:28 MST (-0700)

GTTGCTGGCTCCCCAAGAGCATGTGCACACTTGCTATTGTTTCATTCTTTCTCCACCTGTGCACCTTTTGTAGGCTCAGATAACTCTCAAGTGGGATTTTGTATTATCATCATCTCTCTTGGACTTGAGGATTGTTCAGCAAACTTTCCTTTGCATTTCTGGCCTATGTTTATTATAATATATATACACCCCATTAGTATGTTTTAGAATGTTCATATTTGGCCTTTGATAGGCTTTATAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCCCTCTGGGTTTTTTCCCAGTTGGGCTTGGATATGGGAGTTTGTTGCTGGCTTTGCAAAAATTCAGCTCTCC

Created: 2014-12-08 11:05:30 MST (-0700)
Last modified: 2015-02-01 15:46:10 MST (-0700)
Viewed: 41 times, last viewed: 2016-12-02 03:20:14 MST (-0700)
Show Log