Observation 193851: Lentaria Corner
When: 2014-12-15

Notes: On buried, well-colonized wood amidst cedar, Douglas fir, white fir, sugar pine, ponderosa pine, dogwood, maple, live oak and madrone.

Note two-spored basidia in micrographs.

Collected for the 17th Annual Yuba Watershed Fungus Foray

Species Lists

Images

493545
493546
493571
1000x Melzer’s – spores on basidium
493572
1000x Melzer’s – spores on basidium
493573
1000x Melzer’s – basidium
493574
1000x Melzer’s – basidium

Proposed Names

58% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS Sequence
By: Alan Rockefeller (Alan Rockefeller)
2014-12-21 11:49:45 CET (+0100)

CTGCGGAAGGATCATTACAGTATGTTCAGAGGTGGCTTTGCTGCTGGCTCCTTTCCCGGAGCATGTGCGCGCCCCTCGCCTTCATCCATATACACTTGTGCACCTCGGTCGAAGCCTCCCGTCTGGAGCCGCCTCGCTTTACCGCTTGGCTGAGGCCTCGACTGCTTTATTACACTACAGCCTGTCTTTAACGCATGTCTAATGTCCTACGGGATGATATTAAATACAACTTTCAACAACGGATCTCTTGGCTTTCGCATCGATGAAGAACGCCGCGAAAGTGCGAAACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCTTGAACTCTCTCAACCCCTCCCCTTTCTCTATTCTGAGTGAGGGCTCTCGGGTTGGATTTGGACACCTGCCGCGGGGTTTCGACCCTTGACGGCTCGTCTTGAAATGCATCAGCTGGTCCACCACATGAGCTCGGTTCAACAACGGTGTGATAAGAAACGCTTCGT

Created: 2014-12-17 03:49:11 CET (+0100)
Last modified: 2014-12-17 04:26:47 CET (+0100)
Viewed: 27 times, last viewed: 2016-10-27 12:20:43 CEST (+0200)
Show Log