Observation 193880: Pachycudonia spathulata (S. Imai) S. Imai
When: 2014-12-15

Notes: In hardwood leaf litter.

Spores four-septate, needle-like, in asci shaped like what we used to call dart grass as kids at summer camp. Asci 8-spored. Paraphyses bent/curled at ends. All tissues inamyloid.

Collected for the 17th Annual Yuba Watershed Fungus Foray

Proposed Names

29% (1)
Recognized by sight
29% (1)
Recognized by sight
30% (2)
Based on chemical features: Based on a BLAST search of the ITS sequence
58% (1)
Eye3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
interesting forma/color
By: Debbie Viess (amanitarita)
2017-04-26 16:14:13 EDT (-0400)

for the former Cudonia spathulata.

GenBank KY867550
By: Alan Rockefeller (Alan Rockefeller)
2017-04-26 16:01:44 EDT (-0400)
I’ve asked Daniel Nicholson
By: Danny Newman (myxomop)
2017-03-25 12:36:51 EDT (-0400)

to chime in on the off, off chance he remembers the collection. My memory is failing me. I don’t think I collected it, otherwise I would have given a more specific location. I didn’t even remember it being sequenced.

deja vu
By: Debbie Viess (amanitarita)
2017-03-25 12:11:50 EDT (-0400)

all over again.

just like we toyed with the names Cudonia and Spathularia here in MO, so did the original Japanese namers of this curious species, in all of its interpretations!

Here’s a page with its history. Even the name Pachycudonia was proposed over a half century ago!

http://www.mycobank.org/...

Do you have
By: Noah Siegel (Noah)
2017-03-25 12:02:48 EDT (-0400)

a more precise location for this?

There are very few collections of this species (which was described from Big Basin, in Santa Cruz, Co.).

Thanks, Noah
By: Danny Newman (myxomop)
2017-03-25 11:58:13 EDT (-0400)

is this a non-spathulate form you’ve encountered before?

EDIT: I see from Imai’s figure that this is precisely the shape it ought to have. wondering then where such a misleading epithet comes from.

I BLASTEDed that too
By: Danny Newman (myxomop)
2014-12-22 15:14:08 EST (-0500)

and came up with a mix of Cudonia and Spathularia results. granted, I may not have known what I was doing. I started here:

http://blast.ncbi.nlm.nih.gov/...

and pasted in the ITS sequence (which I thought was meaningless for ascos…), which gave me the following results:

http://i.imgur.com/DdbPQaN.png

there are multiple entries with 100% values in the Query Cover column, including both Cudonia and Spathularia, but none above 97% in the Ident. column.

Please feel free to correct me if I’ve missed something. My experience with sequencing and genetic data interpretation is slim.

macro a better match for Cudonia, too.
By: Debbie Viess (amanitarita)
2014-12-22 12:58:48 EST (-0500)

but I have never seen such a bright orange form before.

ITS Sequence
By: Alan Rockefeller (Alan Rockefeller)
2014-12-21 06:49:52 EST (-0500)

GCCATATTCTCACCCTTTGTATACCTATTACCTTGTTGCCTTGGCAGGCTGGTAACAGCCTGCCAGTGGACCTCAACTCTAGAATCTCTGCTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTACTCCAGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCACGCCTAGCGTGGTCTTGGGCTCGCCCTGCAGGGCCTGCCTCAAAGTCAGTGGCGGCATTGTCTAACCCCTAAGCGTAGTAACATACACCTCACTTTTGGGCGCTGGATGGAGGCTTGCTATGAACCCCCAACTCTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA

Created: 2014-12-16 23:44:34 EST (-0500)
Last modified: 2017-04-02 06:31:38 EDT (-0400)
Viewed: 229 times, last viewed: 2017-07-20 02:10:37 EDT (-0400)
Show Log