Observation 193880: Cudoniaceae P.F. Cannon
When: 2014-12-15

Notes: In hardwood leaf litter.

Spores four-septate, needle-like, in asci shaped like what we used to call dart grass as kids at summer camp. Asci 8-spored. Paraphyses bent/curled at ends. All tissues inamyloid.

Collected for the 17th Annual Yuba Watershed Fungus Foray

Species Lists

Images

493652
493653
1000x Melzer’s – asci
493654
1000x Melzer’s – asci
493655
1000x Melzer’s – asci and spores

Proposed Names

29% (1)
Recognized by sight
29% (1)
Recognized by sight
30% (2)
Based on chemical features: Based on a BLAST search of the ITS sequence
58% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
I BLASTEDed that too
By: Danny Newman (myxomop)
2014-12-22 15:14:08 CST (-0500)

and came up with a mix of Cudonia and Spathularia results. granted, I may not have known what I was doing. I started here:

http://blast.ncbi.nlm.nih.gov/...

and pasted in the ITS sequence (which I thought was meaningless for ascos…), which gave me the following results:

http://i.imgur.com/DdbPQaN.png

there are multiple entries with 100% values in the Query Cover column, including both _Cudonia and Spathularia, but none above 97% in the Ident. column.

Please feel free to correct me if I’ve missed something. My experience with sequencing and genetic data interpretation is slim.

macro a better match for Cudonia, too.
By: Debbie Viess (amanitarita)
2014-12-22 12:58:48 CST (-0500)

but I have never seen such a bright orange form before.

ITS Sequence
By: Alan Rockefeller (Alan Rockefeller)
2014-12-21 06:49:52 CST (-0500)

GCCATATTCTCACCCTTTGTATACCTATTACCTTGTTGCCTTGGCAGGCTGGTAACAGCCTGCCAGTGGACCTCAACTCTAGAATCTCTGCTGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTACTCCAGGGGGCATGCCTGTTCGAGCGTCATTACAACCCTCACGCCTAGCGTGGTCTTGGGCTCGCCCTGCAGGGCCTGCCTCAAAGTCAGTGGCGGCATTGTCTAACCCCTAAGCGTAGTAACATACACCTCACTTTTGGGCGCTGGATGGAGGCTTGCTATGAACCCCCAACTCTACAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGA

Created: 2014-12-16 23:44:34 CST (-0500)
Last modified: 2014-12-22 15:02:39 CST (-0500)
Viewed: 158 times, last viewed: 2016-12-03 10:34:22 CST (-0500)
Show Log