Observation 194211: Psathyrella piluliformis (Bull.) P.D. Orton
When: 2014-12-13
Who: Byrain

Notes: This was collected by someone else for the 17th Annual Yuba Watershed Fungus Foray and appears to be cespitose on on fallen coniferous needles. The taste was farinaceous, the images do not represent where these were found.

Spores with minute germ pore.
Spore range = 5 – 6 × 3 – 4 µm
Spore average = 5.35 × 3.28 µ
Q range = 1.38 – 2
Q average = 1.65
Lamellar cystidia sometimes slightly thick walled and yellowish.
Cheilocystidia measured = 20×14, 25×9, 26×10, 28×11, 29×11, 30×10, 30×11, 32×10, 32×12, 33×11, 38×13, 38×13 µ
Pleurocystidia measured = 32×11, 35×13, 36×10, 36×11, 37×11, 38×12, 38×12, 38×17, 39×10, 40×12, 40×13, 41×11, 41×11, 42×11, 45×11, 45×12, 48×12 µ
Basidia 4-spored.

Using Smith’s Psathyrella monograph this keys out as P. alaskaensis which is described as a satellite taxon to P. hydrophilia (=P. piluliformis) with slightly thickened pleurocystidia that are yellowish in KOH, but it seems that Smith reached the wrong conclusion in thinking that was grounds for a new species and P. piluliformis is also known to have lamellar cystidia that are sometimes thickened and yellowish like this collection. The DNA sequence below thanks to Alan seems to support this.

ACTATGGCGTTGGTTGTAGCTGGCTCCTAGGAGCATGTGCACACCCGTCATTCTTATCTTTCCACCTGTGCACTTAATGTAGGTCTGGATAACTCTCGCTCATACCGAGCGGATGCAGGGATTGCCGTGTCGAAAGACCGGCTCTCTTTGAATTTCCAGGTCTATGTACCTTTACAAACTCCAATTGTATGATAATGAATGTAGTCAATGGGCTTTCAAGCCTATAAAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTTCATCAGCTTTGTTATGAAACTGTGTGGAGCTTGGATGTGGGGGTTTGTGCAGAGCGCGTAAAAGCAACCTGCTCCCCTTAAATAAATTAGCGAGTTCAAACTGGGCTCCGTCTATTGGTGTGATAATTATCTACGCCGTGGATTGGGTTTAGACTTGCTTCTAATCGTCCGCAAGGACAATCTTTTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTGGTCTTCGGCCATCCGAGTTGTAATCTAGAGAAGCGTTACCCGCGTCGGACCGTGTACAAGTCTCCTGGAATGGAGCAT

Here are some sequences that are 100% matches.

#Psathyrella_piluliformis_gi334352354 FN396113 Unknown location
#Psathyrella_sp.TENN61767_gi223452211 FJ596872 USA: TN, Great Smoky Mountains National Park (from this paper)
#Psathyrella_piluliformis_gi334352377 FN396136 Unknown location (from this paper)
#Conocybe_appendiculata_gi344333553 JF908596 Italy (from this paper)
#Psathyrella_sp._MLB-2010b
gi315270751 HQ604761 Pacific Northwest

Images

494647
494648
494649
494650
494651
494652
Spores, 1000x, Mounted in H2O
494653
Spores, 1000x, Mounted in H2O
494654
Spores, 1000x, Mounted in H2O
494655
Spores, 1000x, Mounted in H2O, 1 µ divisions
494656
Spores, 1000x, Mounted in KOH
494657
Cheilocystidia in KOH
494658
Pleurocystidia in KOH
494659
Pleurocystidia in H2O
494660
Pileipellis mounted in H2O

Proposed Names

92% (2)
Eye3 Eyes3
Recognized by sight
Used references: North American Species of Psathyrella
http://www.vielepilze.de/...
Based on microscopic features
Based on chemical features

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-12-21 14:06:31 PST (-0800)
Last modified: 2014-12-21 22:16:49 PST (-0800)
Viewed: 65 times, last viewed: 2016-10-08 03:36:07 PDT (-0700)
Show Log