Observation 194507: Roridomyces Rexer
When: 2014-12-14
No herbarium specimen

Notes: Seen at the Nevada City Fungus Fair, in a small petri dish.

I didn’t photograph it – if anyone did, please let me know.

The stipe was very viscid and the stipe and cap were nearly white, perhaps with a hint of grey. Growing in oak debris.

The same species occurs in Norway, with a 1 or maybe 2 base pair ITS difference.

ITS sequence:

TTGAAGCTGGCCTTTCGAGGTAACACGCGCCCGTCGTATCATCTACCCTTCTTTTTTGTGCACCACCGTAGTCTTTGACGTCAGTGGAGAAGTGGAGGCCTAACACGCTTCCGGTAAGGTCATCAGTGGCCTTTCGCTCTGGACAGAAGCCTTGTGCTTCGATAAGACTAATATATAAACGAATGTATGTCTAGAATGTCACTTATGGCTTCGGCCATTAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAACTAATGTGAATTGCAGAATCCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCTTTAATATCTATCAACCATTTTGTGTGCTTGCATGCAGCTTGGCTTGGATGTGAGGGTTATTGCTGGCTTTCGTGGTCTGCTCCCTTTAAATGCATTAGTGGAATCTTCCTGCAGCCGGTCTTTCCGTGTGATATACCTTTACGCGGTCTGTACTTGTGGGGAGGCCTGCTCATAACCGTCCGAAAGGACAATTTTCTTAAGACATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAACCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCCCTGTGGCCGTCCGAGTTGTAATTTAGAGAAGCGTTATCCACGCTGGACCGTGTACAANTCA

Proposed Names

92% (2)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-12-23 01:40:54 CST (-0500)
Last modified: 2014-12-23 20:01:11 CST (-0500)
Viewed: 25 times, last viewed: 2016-05-06 21:08:02 CDT (-0400)
Show Log