Observation 194507: Roridomyces Rexer

Notes:
Seen at the Nevada City Fungus Fair, in a small petri dish.

I didn’t photograph it – if anyone did, please let me know.

The stipe was very viscid and the stipe and cap were nearly white, perhaps with a hint of grey. Growing in oak debris.

The same species occurs in Norway, with a 1 or maybe 2 base pair ITS difference.

ITS sequence:

TTGAAGCTGGCCTTTCGAGGTAACACGCGCCCGTCGTATCATCTACCCTTCTTTTTTGTGCACCACCGTAGTCTTTGACGTCAGTGGAGAAGTGGAGGCCTAACACGCTTCCGGTAAGGTCATCAGTGGCCTTTCGCTCTGGACAGAAGCCTTGTGCTTCGATAAGACTAATATATAAACGAATGTATGTCTAGAATGTCACTTATGGCTTCGGCCATTAACAAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAATTGCGATAACTAATGTGAATTGCAGAATCCAGTGAATCATCGAGTCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCTTTAATATCTATCAACCATTTTGTGTGCTTGCATGCAGCTTGGCTTGGATGTGAGGGTTATTGCTGGCTTTCGTGGTCTGCTCCCTTTAAATGCATTAGTGGAATCTTCCTGCAGCCGGTCTTTCCGTGTGATATACCTTTACGCGGTCTGTACTTGTGGGGAGGCCTGCTCATAACCGTCCGAAAGGACAATTTTCTTAAGACATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAACCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCCCTGTGGCCGTCCGAGTTGTAATTTAGAGAAGCGTTATCCACGCTGGACCGTGTACAANTCA

Species Lists

Images

495068
Roridomyces-tree.jpg

Proposed Names

93% (2)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2014-12-23 07:40:54 CET (+0100)
Last modified: 2018-03-22 11:44:38 CET (+0100)
Viewed: 49 times, last viewed: 2018-05-23 02:41:51 CEST (+0200)
Show Log