Observation 195234: Stropharia cyanea (Bull.) Tuom.
When: 2014-09-30
No herbarium specimen

Notes: Jérôme Legros collection.

ITS sequence:

CTGCGGAGGATCATTATTGAATGAACTTGGCTTGGTTGTTGCTGGCTTCTTTGGAGGCATGTGCACACCTTGTCATCTTTATATCTCCACCTGTGCACCTCTTGTAGACCTGGATTCAACATTTCCGAGGCAACTCGGTCGTGAGGAATTGCTTAACCAGCTTTCCTTGGTAGTCTCCAGGCCTATGTTTTTCATATACACCATAAGAATGTAACAGAATGTAATTATTAGACTTGATTGTCTTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTATCAGTTTTACTGGTGAATGGCTTGGATGTGGGAGTTGCTGGTTTCATGTTTTTGAAATCAGCTCTTCTGAAATGCATTAGCTGGTTGCCTTGTGCAAACTTGTCTATTGGTGTGATAATTATCTACGCCGTGGACTTGCATGAATGAGCACTGCTTATAATCGTCTGTAAAGACAATCTATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT

Images

496894
DSCN2102.JPG
496895
DSCN2103.JPG
496896
RSCN2114.JPG
496897
RSCN2115.JPG
496898
DSCN2100.JPG
496899
DSCN2097.JPG
496900
DSCN2095.JPG
497265
Bluestroph-tree.jpg
Phylogenetic tree generated with the on Maximum Likelihood algorithm
498065
stropharia-2.jpg
A new, better tree which includes sequences from UNITe

Proposed Names

29% (1)
Eye3
Recognized by sight
81% (1)
Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Almost identical
By: Irene Andersson (irenea)
2015-01-02 16:32:37 CST (-0500)

with Estonian Stropharia cyanea at Unite. I compared with the three collections there, and they differed 1, 2 and 5 bits (all in different places)…

psilocybin?
By: Joe Soeller (slephy)
2015-01-02 16:32:06 CST (-0500)

Presence of psilocybin?

Created: 2014-12-30 20:46:56 CST (-0500)
Last modified: 2015-01-06 18:29:09 CST (-0500)
Viewed: 98 times, last viewed: 2016-12-20 01:09:57 CST (-0500)
Show Log