Observation 195424: Amanita “sp-AUS08” Tulloss & Kudzma cryptonom. temp.
When: 2014-12-30
0 Sequences

Notes:
May be see Observation: Amanita sect. Vaginatae sensu Zhu L. Yang (163300)
Cap just showing and surface area cleared. Amanita in wet soft soil Semi rainforest in part shade.

Proposed Names

ret
74% (2)
Eye3 Eyes3
Based on chemical features: nrITS sequence comparison to MO 202072…see comments, below.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Selected images now on website.
By: R. E. Tulloss (ret)
2016-12-16 12:48:57 CST (-0500)
You’re welcome, Ian.
By: R. E. Tulloss (ret)
2016-12-08 14:34:02 CST (-0500)

R

Watching results with interest & awe

Rod, Thanks for the link to Observation 102465: Amanita sect. Vaginatae sensu Zhu L. Yang. It really does add interest in the procedings. Can can only watch and wait in awe.

The roll continues.
By: R. E. Tulloss (ret)
2016-12-08 10:53:38 CST (-0500)

See:

http://mushroomobserver.org/102465?q=sFQ

Amanitawilliamsiae” is a member of the “TCT…” group.

Thank yous are posted on the above observation.

Very best,

Rod

Reply to Igor is ….
By: R. E. Tulloss (ret)
2016-12-08 08:49:00 CST (-0500)
Well, we got on just a little bit of a “roll” yesterday.
By: R. E. Tulloss (ret)
2016-12-08 08:47:35 CST (-0500)

Thanks for you comment, Ian.

Very best,

Rod

Rod

Just catching up. “08” gaining data. WoW. kk

Here is an observation…
By: I. G. Safonov (IGSafonov)
2016-12-08 00:21:10 CST (-0500)

… of what is possibly A. williamsiae, collected from the NJ Pine Barrens a few years ago: http://mushroomobserver.org/102465?q=sFQ.
Rod, was this material ever sequenced?

The list of taxa (and unnamed collections) with the “TCT” variant at the …
By: R. E. Tulloss (ret)
2016-12-07 21:11:13 CST (-0500)

beginning of nrLSU can be found at the end of the discussion data field here:

http://www.amanitaceae.org?Amanita%20penetratrix

Amanitasp-AUS08” is the first, known, brightly-colored member of the group (athough we suspect that Amanitawilliamsiae” will turn out to be another yellow species in the group).

http://www.amanitaceae.org?Amanita%20williamsiae)

Very best,

Rod

One more thing.
By: R. E. Tulloss (ret)
2016-12-07 20:33:10 CST (-0500)

So sp-AUS08 becomes still one more member of section Vaginatae with the unusual first characters (5’ motif) of the nrLSU gene that we originally saw in A. penetratrix and are now finding in many parts of the world.

Here is the 5’ motif shown in the context from which we recovered it. It begins at the eleventh character in the following string:

TTATGATTCATCTGACCTCAAATCAGGTAGGATTACCCGC

The initial TTATGATTCA is the end of the “proposed fungal barcode” in the present species. The remainder of the above is the beginning of (the 5’ end of) nrLSU.

Very best,

Rod

Well there WAS more to find out.
By: R. E. Tulloss (ret)
2016-12-07 20:27:33 CST (-0500)

I was able to recover about half of the “proposed fungal barcode” gene and discovered that strongly matches with the same piece of the “barcode” gene from 202072. The yellow-dominated taxa of this observation and 202072 seem to have a high likelihood of being the same species.

Whattaya know?

This species seems classifiable as Amanitasp-AUS08.”

Very best,

Rod

However, I can see in one of the reads that the LSU 5’ motif is the TCT
By: R. E. Tulloss (ret)
2016-12-07 16:41:12 CST (-0500)

variant motif.

Maybe there is more to be said here.

Very best,

Rod

We did not obtain good quality sequences from this material.
By: R. E. Tulloss (ret)
2016-11-30 23:25:35 CST (-0500)

Thank you for giving us an opportunity to try.

Very best,

Rod

Thanks Ian,
By: groundhog
2015-03-10 17:27:58 CDT (-0400)

This material has been received and accessioned to Rod’s herbarium. We have also scheduled it for DNA sequencing.
Thanks,
Naomi

Created: 2015-01-03 02:26:06 CST (-0500)
Last modified: 2016-12-08 13:43:21 CST (-0500)
Viewed: 145 times, last viewed: 2017-10-11 20:50:11 CDT (-0400)
Show Log