Observation 198254: Gloeoporus dichrous (Fr.) Bres.
When: 2014-11-28

Notes: On dead hardwood branch (maybe tanbark oak). Specimen was thin, tubes were shallow and rubbery. ID is based on ITS sequence:

TAACGAGTTCTTGAACGGGTTGTAGCTGGCTCTTTTTTTAGGAGCATGTGCACGCCTGGCTCAATTCCACTCCTTAACCTCTGTGCACTTATTGTAGGTCGGTGGAGGCTGGCGCAAGTCAGTTTGAAGCCTTCCTATGTTTTATTACAAACRTGTCAGTTATAGAATGTCTTACTTTGCTATAATGCAATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCACCCCTTGGTATTCCGAGGGGTATGCCTGTTTGAGTGTCATGGTATTCTCAACCCCCAAATTCTTTATTGAGTCTTGGTGGGCTTGGACTTGGAGGTTGTGCTGGATTTTTATTAATTCAGCTCCTCTGAAATACATTAGTGTGAATCTTACGGATCGCCTTCAGTGTGATAATTGTCTACGCTGTGGTTGTGAAGTATATTTGTA

Proposed Names

83% (1)
Eye3 Eyes3
Based on microscopic features: Monomitic, thick-walled, clamped hyphae, no cystidia, spores not found
Based on chemical features: ITS Sequence

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Spores were tiny and allantoid
By: Tom Bruns (pogon)
2015-02-07 14:36:10 CST (-0600)

3.9-4.2 X 1.2

Created: 2015-02-07 14:10:31 CST (-0600)
Last modified: 2015-02-07 14:10:39 CST (-0600)
Viewed: 27 times, last viewed: 2017-06-19 20:35:20 CDT (-0500)
Show Log