Observation 198256: Punctularia subhepatica (Berk.) Hjortstam
When: 2014-12-06

Notes: This specimen was given to me at the San Francisco Mycological Society Fungus Fair, by ???? (sorry I don’t remember the name), who had a strong interest in polypores. The purple color is very distinctive, and I’m sure I have seen this before and not successfully identified it. The current specimen does not seem to be mature as I could not find fertile basidia or spores, but it does have dendrohyphidia, and clamps, which are consistent with the ID. The ITS sequence is a 95% match to P. strigososonata. This what the identification is primarily based on. The match to the species is poor enough that it probably is something slightly different but related. It also has needle-like crystals (see last photo) which I do not see in the description of P. strigososonata.

Here is the ITS sequence:
GGGCTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTCTCTACACCTGTGCACCTTTTGTGGGCGGGAGGGCGAAAGCCCTTTTGCCCGCGTCTCACACACACATACACCTGGTAGCAGAATGTACACATCGCGTCTTAGAACGCATCATTAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAACATCTCAACCCAGCGACGTTTGCGCGTCGTCTGTGGATTGGACTTGGAGGATTTGCCGGACTGATCACGTCGGCTCCTCTCAAATGCATTAGCTTGGGCTTAGCT

Proposed Names

27% (2)
Eye3
Based on chemical features: ITS Sequence
56% (1)
Eyes3
Based on chemical features: BLAST results show 99-100% match with sequence of a collection from Santa Cruz, CA
-56% (1)
Used references: current name according to IF and Elia Martini

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
I thought it was 99%
By: Danny Newman (myxomop)
2017-02-20 18:01:34 GMT (+0000)

but there’s a very good chance I’m reading the results wrong:

Maybe P. atropururascens sensu lato, but its unlikely to be the same biological species
By: Tom Bruns (pogon)
2017-02-20 16:52:28 GMT (+0000)

Danny – This may fit the gross morphology of P. atropururascens, but with only a 95% ITS match to it, it seems like it must be something a little different. Perhaps an undescribed North American version of it. In any case we need more collections and especially some that are mature and fertile.

finding this useful
By: Danny Newman (myxomop)
2017-02-19 20:35:33 GMT (+0000)

http://www.mycobank.org/...

in reconciling the lack of purple in the Martini description. fitting that this would have been confused for a Ptychogaster throughout its taxonomic history. I’m leaning more toward P. atropurpurascens being the right name after all. any future observations of this stuff should contain detailed analyses of microstructures, whether sexual or asexual, to help clinch the ID.

could be
By: Danny Newman (myxomop)
2017-02-19 20:26:46 GMT (+0000)

right now I’m wondering a few things

1. Is this truly and definitely P. subhepatica?

2. Is P. subhepatica truly and definitely the same as P. atropurpurascens?

3. Are this material, the collection linked from MycoPortal, and Observation 199880 all the same thing?

4. Is Elia Martini’s writeup of that species lacking pictures/mention of the fuzzy purple-ness and exudation that ought to be there, or is the thing on pg. 488 of MotRC a different animal? Does the difference in substrate (Pinus and Acacia for Elia’s material, live oak in MotRC) matter?

Is this the “purple fuzz” on page 488 of the Redwood Coast book?
By: Tom Bruns (pogon)
2017-02-19 19:56:20 GMT (+0000)
Yes, there are multiple purple corticioids
By: Tom Bruns (pogon)
2015-03-10 19:25:18 GMT (+0000)

Hi Danny, – sorry I didn’t remember that you gave me the specimen. I glanced at list of observations you gave below, and I think most or all of them are right. There just are a few purple taxa, and this one may not be the most common. I think for mere mortals like you and I it takes a microscope to sort them out, at least initially. Maybe after you have picked them up a few times they start to sink in. The Punctularia you handed me seemed more fuzzy than Chondrostereum I’ve seen, and more solid than Byssocorticium. But given that it was not mature, I never would have IDed it without the sequence. Next time, maybe. – Tom

that would be me, Tom
By: Danny Newman (myxomop)
2015-03-10 19:00:43 GMT (+0000)

I’m glad this actually made it through the assembly line. I thought for sure I had an observation up of this already, but I don’t appear to have uploaded anything from the fair. I’ll remedy that sometime soon.

The question now is to which of these:

http://mushroomobserver.org/species_list/show_species_list/651

this name can be rightly applied.

Created: 2015-02-07 20:32:39 GMT (+0000)
Last modified: 2017-03-03 18:54:57 GMT (+0000)
Viewed: 139 times, last viewed: 2017-04-03 04:04:46 BST (+0100)
Show Log