Observation 198256: Punctularia Pat.
When: 2014-12-06

Notes: This specimen was given to me at the San Francisco Mycological Society Fungus Fair, by ???? (sorry I don’t remember the name), who had a strong interest in polypores. The purple color is very distinctive, and I’m sure I have seen this before and not successfully identified it. The current specimen does not seem to be mature as I could not find fertile basidia or spores, but it does have dendrohyphidia, and clamps, which are consistent with the ID. The ITS sequence is a 95% match to P. strigososonata. This what the identification is primarily based on. The match to the species is poor enough that it probably is something slightly different but related. It also has needle-like crystals (see last photo) which I do not see in the description of P. strigososonata.

Here is the ITS sequence:
GGGCTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTCTCTACACCTGTGCACCTTTTGTGGGCGGGAGGGCGAAAGCCCTTTTGCCCGCGTCTCACACACACATACACCTGGTAGCAGAATGTACACATCGCGTCTTAGAACGCATCATTAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAACATCTCAACCCAGCGACGTTTGCGCGTCGTCTGTGGATTGGACTTGGAGGATTTGCCGGACTGATCACGTCGGCTCCTCTCAAATGCATTAGCTTGGGCTTAGCT

Species Lists

Images

504951
504952
note dendrohyphidia projecting from hymenium
504953
Linear purplish crystals

Proposed Names

83% (1)
Eye3 Eyes3
Based on chemical features: ITS Sequence

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Yes, there are multiple purple corticioids
By: Tom Bruns (pogon)
2015-03-10 12:25:18 PDT (-0700)

Hi Danny, – sorry I didn’t remember that you gave me the specimen. I glanced at list of observations you gave below, and I think most or all of them are right. There just are a few purple taxa, and this one may not be the most common. I think for mere mortals like you and I it takes a microscope to sort them out, at least initially. Maybe after you have picked them up a few times they start to sink in. The Punctularia you handed me seemed more fuzzy than Chondrostereum I’ve seen, and more solid than Byssocorticium. But given that it was not mature, I never would have IDed it without the sequence. Next time, maybe. – Tom

that would be me, Tom
By: Danny Newman (myxomop)
2015-03-10 12:00:43 PDT (-0700)

I’m glad this actually made it through the assembly line. I thought for sure I had an observation up of this already, but I don’t appear to have uploaded anything from the fair. I’ll remedy that sometime soon.

The question now is to which of these:

http://mushroomobserver.org/species_list/show_species_list/651

this name can be rightly applied.

Created: 2015-02-07 12:32:39 PST (-0800)
Last modified: 2015-02-07 12:32:47 PST (-0800)
Viewed: 54 times, last viewed: 2016-11-28 12:52:08 PST (-0800)
Show Log