Observation 204063: Morchella brunnea M.Kuo

Proposed Names

-35% (2)
Recognized by sight: both sp. identical in hand, both non-burn western morels. send this one to the DNA lab!
IF brunnea, could be a first record for CA.
Used references: Kuo, species descriptions on Mushroomexpert.com

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Thanks Alan!
By: christopher hodge (christopher hodge)
2016-05-17 15:45:39 EDT (-0400)
can’t tell by lookin’!
By: Debbie Viess (amanitarita)
2016-05-17 11:14:42 EDT (-0400)

and rather impractical to run DNA for every morel in dispute.

we found lots of brunnea (or could they be Mel-8??!) as well as snyderi this past weekend up at the OMS foray, and even an apparently unnamed blonde. Wanna run that one, Alan? Could be an unnamed species!

I have it here with me.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 10:52:12 EDT (-0400)

AGGGAGGCATTAGGGGACCGACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCAGTATGGACCCGAAGCCTCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGGCATCTCGTCGGGGGGAGGTAACAACCAAAACTCTCTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAGACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATAATAGGCTTGCAGTAAAATGCTCACCTCTCTCCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACCATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGA

“mel-8” is currently undescribed formally …
By: Debbie Viess (amanitarita)
2015-05-12 14:23:46 EDT (-0400)

but apparently morpho identical to brunnea.

Created: 2015-05-09 00:34:18 EDT (-0400)
Last modified: 2016-05-17 10:47:01 EDT (-0400)
Viewed: 64 times, last viewed: 2016-10-27 03:26:01 EDT (-0400)
Show Log