Observation 204063: Morchella brunnea M.Kuo
When: 2015-05-02
0 Sequences

Proposed Names

-35% (2)
Recognized by sight: both sp. identical in hand, both non-burn western morels. send this one to the DNA lab!
IF brunnea, could be a first record for CA.
Used references: Kuo, species descriptions on Mushroomexpert.com

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Yes
By: christopher hodge (christopher hodge)
2017-03-11 13:20:29 PST (-0800)

This was found in a non burned or disturbed forest.

was this non-burned forest, Christopher?
By: Debbie Viess (amanitarita)
2017-03-10 17:47:54 PST (-0800)
Thanks Alan!
By: christopher hodge (christopher hodge)
2016-05-17 12:45:39 PDT (-0700)
can’t tell by lookin’!
By: Debbie Viess (amanitarita)
2016-05-17 08:14:42 PDT (-0700)

and rather impractical to run DNA for every morel in dispute.

we found lots of brunnea (or could they be Mel-8??!) as well as snyderi this past weekend up at the OMS foray, and even an apparently unnamed blonde. Wanna run that one, Alan? Could be an unnamed species!

I have it here with me.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 07:52:12 PDT (-0700)

AGGGAGGCATTAGGGGACCGACCAGGGCTAGTAGCTTTACGTTGTTGAACGTCCAGTATGGACCCGAAGCCTCCCCCATCTAAACCCTCTGCGTACCTGTCCCTTCTTGCTTCCCCCGGCATCTCGTCGGGGGGAGGTAACAACCAAAACTCTCTGTGAATCAAACAGCCGTCAGAATTATAAAACAAACAAAAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATAAAAACCTCCTCCCCCTTCGGGTTTTGTTACTATCGTTGGGGGGTTTTGGCCTAATGGGATAGCGATTGGCAATTCGTTTCCCAATGTCCTAAATAGACGTAGACCCGCCTCCAGATGCGACAGCACCGAGGCCATCAACCGTGGAGTTATGGGATATAATAGGCTTGCAGTAAAATGCTCACCTCTCTCCACACGCCGATGGCACGACAGTTGCAGTTGCGGGCGTAAATTGGAGCCCTTTTCAGGACCCTCGTGGCCTAGCATCCACCATACATAATTTGACCTCGGATCAGGTAGGGATACCCGCTGA

“mel-8” is currently undescribed formally …
By: Debbie Viess (amanitarita)
2015-05-12 11:23:46 PDT (-0700)

but apparently morpho identical to brunnea.

Created: 2015-05-08 21:34:18 PDT (-0700)
Last modified: 2017-03-12 08:22:08 PDT (-0700)
Viewed: 108 times, last viewed: 2017-11-06 06:00:43 PST (-0800)
Show Log