Observation 206608: Boletaceae Chevall.
When: 2015-06-14

Notes: > These were brought to the NJMA foray by new members who collected them under oaks on their property in Landing, NJ. Unfortunately, as can be seen from the pix, the mushrooms were excessively handled before I took possession.
> The stipal ornamentation is particularly noteworthy and crucial for identification. In the mature fruit body, it consists of a broken red reticulation surrounded by a concolorous pruinosity on the pale yellow background color. The young basidiomata have much more red color in the stipe, and the reticulation is compressed into a highly textured and convoluted pattern toward the apex.
> I understand that the name Boletus/Suillellus luridus pertains to the European mushroom. I am not aware of any published molecular studies that undertook the effort of comparing North American vouchers identified as S. luridus with those from Europe and concluding that this species does indeed occur in the New World. Thus, the North American entities presenting as S. luridus should probably be referred to as S. luridus sensu auct. amer. before their phylogenetic relationships are elucidated.

Molecular Sequencing Discussion:
> Clean and contiguous 1444 bps nrLSU and 812 bps nrITS sequences (including primers) have been obtained for this material.
> The closest BLAST hit involving a red-pored bolete for the 1049 bps fragment (41—>1090) of my LSU sequence was Boletus subvelutipes voucher RV98.102 (GenBank accession AY612804). The 100% overlay was only 97.3% similar (1024/1052 bps, with 3 gaps).
> However, there was a perfect 100% match for a 776 bps fragment (37—>812) of my ITS sequence with MES244 voucher of Boletus cf. subvelutipes (GenBank accession FJ480442, https://www.ncbi.nlm.nih.gov/nuccore/FJ480442) collected near Whipple Hill, MA, by Prof. M. E. Smith.
> A Google search of the above accession number yielded a link to a massive ITS phylogram for the Boletacea at http://mushroomhobby.com/temp/BOLETUS5_WIDE_ML.pdf. Therein, MES244/FJ480442 was on the same unlabeled branch with Neoboletus bruneissimus (!), a bolete from southeast Asia, and claded very closely with Boletus erythropus (now known as Neoboletus luridiformis). It was also in the immediate proximity to the Rubroboletus clade represented by several species.

Later on, I had a serendipitous discovery concerning MES244/FJ480442. A publication by A. Urban & W. Klofac (Sydowia 2015, 67, p. 175-187) shows this collection to be related, to some degree, to Neoboletus xanthopus and Neoboletus luridiformis. As a matter of fact, it was the only non-European red-pored taxon featured in the ITS phylogram therein, suggesting nothing else came close to the two European species upon mining GenBank. Unfortunately, Urban & Klofac don’t elaborate on this interesting connection at all and surprisingly list FJ480442 as B. subvelutipes even though the true identity of this collection has never been established with certainty (and for a good reason as I later discovered!).
Professor M. E. Smith, the collector of MES244/FJ480442, was very gracious to supply a photograph of his voucher (posted here). Most unfortunately, the greater part of the stipe surface below the apex appears to have been severely damaged by insects and/or slugs. What looks like “reticulation” on the lower half of the stipe is likely to be a pattern of bite marks left by the feasting critters. A close examination of the stipal apex near the tube layer shows an intact yellow surface that is apparently devoid of any reticulum. This makes me think that the stipe of MES244/FJ480442 is entirely smooth. This photographic evidence, if interpreted correctly, is in contradiction to the DNA data, and suggests that MES244/FJ480442 and MO206608 may not necessarily be the same entity.

Preliminary Conclusions:
> This collection in all likelihood represents a North American taxon unrelated to the European Suillellus luridus.
> Limited molecular evidence based on a solid nrITS sequencing match in GenBank instead points toward affinity with the smooth-stiped Neoboletus and, to a lesser extent, with Rubroboletus – a genus represented by red-pored, bluing bolete species sporting red reticula on their stipes.
> The matching nrITS sequence suggests this taxon has previously been reported from Massachusetts. On the other hand, examination of morphology of MES244/FJ480442 from a photograph leaves room for doubt that the two boletes are the same species.
> At the generic level, a nrLSU BLAST search did not return any close matches with the known genera of red-pored boletes.

Images

527937
527941
527942
Details of reticulation and pruinosity
527943
KOH on cap
527944
Bluing of context — photographed immediately after dissection
527945
Left to right: staining with NH4OH, KOH and FeSO4
527946
527949
The context on lower stipe was vivid lemon yellow before staining blue
593344
Copyright © 2015 Prof. Matthew E. Smith (University of Florida)
MES244/FJ480442 by Prof. M. E. Smith

Proposed Names

-57% (1)
Used references: 1) North American Boletes by Bessette, Roody, Bessette
2) MushroomExpert.com
Based on chemical features: See pix
28% (1)
Eye3 Eyes3
Based on chemical features: The ITS and LSU sequences obtained for this material don’t match any S. luridus sequences in GenBank. DNA discussion is now posted in the notes section.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nrITS sequence posted
By: I. G. Safonov (IGSafonov)
2016-11-23 17:23:46 PST (-0800)

AAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAAATTCTGAGGGGGAAGATGGGGAGTGCAGACTGTCGCTGGCCTGATCAGGGCATGTGCACGTCTAGCTTTTCGTCGACCTTTCTCTCATACACACACCTGTGCACCCATTGTAGGTCCTCGAAAGAGGATCTATGTTTTTCACATCACACCCGTCGTATGTCTATAGAATGTATTGAGAACGTCGACCTGTTTGACAGGCAGGCGGTCCATAAAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATGTCTTGATTGATTTCGAGGCATGGCTTGGAGTTGGGGGTTGCTGGCGGCGAAACGCCGTCGGCTCTCCTGAAATGCATTAGCAAAAGGGCGGCGAGTCTCTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTTTGGGGAACATGCATGAATCGTCCACTGCTTCCAATCCCTAATCCCCTCTAGCCTTTGAGTCACTTAGCTACTAGCTGGTCGTGAGGCCGGCGAACGTTGGGCGGCCAAGGCTTAGGCTTGGGTGTTTCGAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTA

nrLSU sequence posted
By: I. G. Safonov (IGSafonov)
2016-11-23 17:23:06 PST (-0800)

TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTTGAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCCAGGGATCAACCTTGCTTCTCGCTCGGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGGGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTTTCGTCGTATGCGGCGCTCGGGACTGAGGAACTCAGCATGACTTCGCGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGCCAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTTGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC

DNA discussion UPDATED & another pic uploaded
By: I. G. Safonov (IGSafonov)
2016-01-23 13:37:12 PST (-0800)
Hi Igor
By: Martin Livezey (MLivezey)
2016-01-03 13:33:00 PST (-0800)

It is a great looking bolete, one that I would call a dead ringer for B. subvelutipes except that the stipe does not fit at all! I wonder if it will be in the new book from the Besettes. I personally relish this new stage of analysis /pylogeny as exemplified by your post. Have you posted to GenBank? It would be a great addition to have the sequence there for this discussion (or at least a future discussion).

Hello, Martin
By: I. G. Safonov (IGSafonov)
2016-01-03 12:31:24 PST (-0800)

No, unfortunately I didn’t record either. I don’t usually engage in tasting of mushrooms unless it’s a necessary part of the ID process, like for the Russulaceae. Furthermore, I don’t taste mushrooms brought in by others. As far as aromas are concerned, my nose is not very discerning and I am also very bad at describing odors.

Nice work I.G.
By: Martin Livezey (MLivezey)
2016-01-03 12:19:21 PST (-0800)

Alright, everyone who cares about Boleteaceae, IT IS NOW TIME TO PILE ON!
I am kidding of course!

One preliminary question: was there any aroma or taste recorded? Nothing in your notes.

DNA discussion posted
By: I. G. Safonov (IGSafonov)
2016-01-03 11:59:50 PST (-0800)
Thanks, Walter
By: I. G. Safonov (IGSafonov)
2015-06-14 18:30:27 PST (-0800)

I have never collected the lurid bolete it in NJ, though I do remember to have seen something like it once at the 2012 NEMF foray in E. Stroudsburg. Had to consult a few references before arriving at the ID.

Nice Igor.
By: walt sturgeon (Mycowalt)
2015-06-14 17:52:38 PST (-0800)

Created: 2015-06-14 17:13:21 PST (-0800)
Last modified: 2016-12-02 11:53:45 PST (-0800)
Viewed: 218 times, last viewed: 2016-12-02 11:53:48 PST (-0800)
Show Log