Observation 206608: Boletaceae Chevall.
When: 2015-06-14

Notes: > These boletes were brought to the NJMA foray by new members who found them under oaks on their property in Landing, NJ. Unfortunately, as can be seen from the pix, the mushrooms were excessively handled before I took possession.
> The netting on the stipe is particularly noteworthy and crucial for identification. In the mature fruit body, the somewhat broken, irregular and scruffy vivid-red reticulation contrasts the pale yellow background color. The surface inside reticulation “cells” has a smattering of the same red scruffiness. The young basidiomata have much more red color in the stipe, and the reticulation is compressed into a highly textured and convoluted pattern, especially toward the apex.
> I understand that the name Boletus/Suillellus luridus pertains to the European mushroom. I am not aware of any published molecular studies that undertook the effort of comparing North American vouchers identified as S. luridus with those from Europe and concluding that this species does indeed occur in the New World. Thus, the North American entities presenting as S. luridus should probably be referred to as S. luridus sensu auct. amer. before their phylogenetic relationships are elucidated.

Molecular Sequencing Results Updated Feb-24-2017:
>> Clean and contiguous 1444 bps nrLSU and 725 bps nrITS sequences have been obtained for this material.
>> A BLAST search of a nrLSU sequence fragment (the first 979 characters) gave the following top hits (sorted by identity):
1) Neoboletus sp. ‘vividivelutinus’ voucher JLF2993 (#KU160161) = 914/927 = 98.6% similarity (12 bases off + 1 gap)
2) Boletus erythropus voucher 3131 (KF030291) = 852/867 = 98.3% similarity (14 bases off + 1 gap). B. erythropus = B. luridiformis = Neoboletus luridiformis = Sutorius luridiformis. This North American voucher has clearly been misidentified, as its LSU sequence is very different from the those of authentic vouchers from Europe (e.g., JQ326995 & KM198315).
3) Hits Nos. 3-5 were all members of Rubroboletus (98.1% similarity for all 3 hits)
While these top 5 hits have only 98.1-98.6% similarity, all of them represent red-pored bluing boletes from the poorly-resolved “Pulveroboletus Group” of Wu et al. (2014, 2016). All of this makes good sense – my bolete belongs there, too, and morphology alone is enough to place it there.
Of particular interest is Neoboletus sp. ‘vividivelutinus’, a North American taxon collected in Oregon. The notation suggests an unpublished species or a book entry. I couldn’t find any specific information on this entity upon searching Google.
>> Just in (Feb-24-16): this LSU sequence is 100% identical to the LSU sequences of obs 243052, obs 244427 and obs 251141.
-————————————————————————-
>> I had much better luck with my ITS search:
There was a perfect 100.0% match for the 37—>726 fragment of my sequence with Boletus cf. subvelutipes MES244 voucher (GB accession FJ480442) collected near Whipple Hill, MA.
The second best hit was a nearly perfect match of 99.5% (1 gap) with Boletus subvelutipes voucher JLF2552 (KC812311).
The third best match at 99.2% similarity was Boletus subluridellus isolate 3693 (KM248927). All of the 5 mismatching bases in this GB sequence are represented by ambiguous characters (N & R), so the similarity is probably higher and approaching the first two hits.
Following these three top hits, there was a dramatic drop-off in the similarity to below 95%, so the rest of the list is irrelevant.
Prof. M. E. Smith, the collector of top-scoring MES244/FJ480442, was very gracious to supply a photograph of his voucher (posted here) via Prof. R.E. Halling. Most unfortunately, the greater part of the stipe surface/skin below the apex appears to have been eaten away by insects and/or slugs. What looks like “reticulation” on the lower half of the stipe is likely to be a pattern of bite marks left by the feasting critters. A close examination of the stipe apex near the tube layer shows an intact yellow surface, devoid of any reticulum. This makes me think that the stipe of MES244/FJ480442 is entirely smooth. This photographic evidence, if interpreted correctly, suggests that MES244/FJ480442 and MO206608 may not necessarily be the same entity.

Discussion/Conclusions Updated Feb-24-2017:
> This collection in all likelihood represents a North American taxon unrelated to the European Suillellus luridus.
> Molecular evidence from the most recent nrLSU BLAST searches points toward affinity with the smooth-stiped Neoboletus and with reticulated Rubroboletus. Both genera are represented by red-pored, bluing bolete species. +Furthermore, the LSU sequence of 206608 is totally identical to those of three phenotypically unique collections of North American red-pored boletes that have recently been posted to MO (vide supra). Since there is little doubt that at least three of these entities do not represent the same taxon, as evidenced by gross morphology, this discovery suggests that the large ribosomal unit had not undergone any changes following speciation. It remains to be seen if other phylogenetically relevant loci (TEF-1 and RPB) are capable of resolving these entities.
> The nrITS BLAST search returned three identical or nearly identical hits associated with taxa in the Boletus subvelutipes group. While B. subvelutipes is a highly variable taxon, a phenomenon than led some mycologists to speculate that it could be a species complex, this bolete has a smooth stipe, and its field identification is not particularly difficult with enough practice. However, MO206608 is clearly not Boletus subvelutipes, which lead the obvious question of why the ITS results contradict the morphology.
> The utility of the ITS locus, “the universal DNA barcode for fungi” (Schoch, 2012), to discern species in a genus lies in its variability. So, how can two morphologically distinct taxa have identical ITS sequences? A possible explanation is offered by Feng et al. (2012) in their study of the porcini mushrooms: “ITS sequences may have evolved slower than morphological characters in a species complex. This phenomenon has been reported from some ectomycorrhizal fungi that have undergone recent adaptive radiations, such as species in Cortinarius.”
> Given the unique set of morphological characters associated with MO206608 and the inconclusive evidence from DNA sequencing stemming from the absence of relevant data and also the presence of contradictory data vis-a-vis certain clades of red-pored North American Boletes, especially the “B. subvelutipes group”, the identity of this bolete and its precise phylogenetic position in the Boletaceae is yet to be determined, pending further research. However, it appears that MO206608 is not related to any known European taxa of red-pored boletes, as evidenced by lack of molecular support from GenBank.

Images

527937
527941
527942
Details of reticulation and pruinosity
527943
KOH on cap
527944
Bluing of context — photographed immediately after dissection
527945
Left to right: staining with NH4OH, KOH and FeSO4
527946
527949
The context on lower stipe was vivid lemon yellow before staining blue
593344
Copyright © 2008 Prof. Matthew E. Smith (University of Florida)
MES244/FJ480442 by Prof. M. E. Smith

Proposed Names

-74% (2)
Used references: 1) North American Boletes by Bessette, Roody, Bessette
2) MushroomExpert.com
Based on chemical features: See pix
28% (1)
Eye3 Eyes3
Based on chemical features: The ITS and LSU sequences obtained for this material don’t match any S. luridus sequences in GenBank. DNA discussion is now posted in the notes section.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
DNA sequencing results and discussion UPDATED
By: I. G. Safonov (IGSafonov)
2017-01-08 03:08:32 COT (-0500)

I’ve populated the DNA Results section with my recent analysis of GB searches and updated the Discussion/Conclusions section accordingly. I’ve also removed parts of the old text as I felt they were no longer relevant or important in light of the new data. The previous version of these notes dates back from about a year ago.

nrITS sequence posted
By: I. G. Safonov (IGSafonov)
2016-11-23 20:23:46 COT (-0500)

AGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAAATTCTGAGGGGGAAGATGGGGAGTGCAGACTGTCGCTGGCCTGATCAGGGCATGTGCACGTCTAGCTTTTCGTCGACCTTTCTCTCATACACACACCTGTGCACCCATTGTAGGTCCTCGAAAGAGGATCTATGTTTTTCACATCACACCCGTCGTATGTCTATAGAATGTATTGAGAACGTCGACCTGTTTGACAGGCAGGCGGTCCATAAAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATGTCTTGATTGATTTCGAGGCATGGCTTGGAGTTGGGGGTTGCTGGCGGCGAAACGCCGTCGGCTCTCCTGAAATGCATTAGCAAAAGGGCGGCGAGTCTCTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTTTGGGGAACATGCATGAATCGTCCACTGCTTCCAATCCCTAATCCCCTCTAGCCTTTGAGTCACTTAGCTACTAGCTGGTCGTGAGGCCGGCGAACGTTGGGCGGCCAAGGCTTAGGCTTGGGTGTTTCGAAAC

nrLSU sequence posted
By: I. G. Safonov (IGSafonov)
2016-11-23 20:23:06 COT (-0500)

TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTTGAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGACCGTGTATAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCCAGGGATCAACCTTGCTTCTCGCTCGGTGTACTTCCTGGTCGACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGGGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTTTCGTCGTATGCGGCGCTCGGGACTGAGGAACTCAGCATGACTTCGCGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGCCAAACCCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTTGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC

DNA discussion UPDATED & another pic uploaded
By: I. G. Safonov (IGSafonov)
2016-01-23 16:37:12 COT (-0500)
Hi Igor
By: Martin Livezey (MLivezey)
2016-01-03 16:33:00 COT (-0500)

It is a great looking bolete, one that I would call a dead ringer for B. subvelutipes except that the stipe does not fit at all! I wonder if it will be in the new book from the Besettes. I personally relish this new stage of analysis /pylogeny as exemplified by your post. Have you posted to GenBank? It would be a great addition to have the sequence there for this discussion (or at least a future discussion).

Hello, Martin
By: I. G. Safonov (IGSafonov)
2016-01-03 15:31:24 COT (-0500)

No, unfortunately I didn’t record either. I don’t usually engage in tasting of mushrooms unless it’s a necessary part of the ID process, like for the Russulaceae. Furthermore, I don’t taste mushrooms brought in by others. As far as aromas are concerned, my nose is not very discerning and I am also very bad at describing odors.

Nice work I.G.
By: Martin Livezey (MLivezey)
2016-01-03 15:19:21 COT (-0500)

Alright, everyone who cares about Boleteaceae, IT IS NOW TIME TO PILE ON!
I am kidding of course!

One preliminary question: was there any aroma or taste recorded? Nothing in your notes.

DNA discussion posted
By: I. G. Safonov (IGSafonov)
2016-01-03 14:59:50 COT (-0500)
Thanks, Walter
By: I. G. Safonov (IGSafonov)
2015-06-14 21:30:27 COT (-0500)

I have never collected the lurid bolete it in NJ, though I do remember to have seen something like it once at the 2012 NEMF foray in E. Stroudsburg. Had to consult a few references before arriving at the ID.

Nice Igor.
By: walt sturgeon (Mycowalt)
2015-06-14 20:52:38 COT (-0500)

Created: 2015-06-14 20:13:21 COT (-0500)
Last modified: 2017-02-24 11:21:45 COT (-0500)
Viewed: 284 times, last viewed: 2017-03-12 21:30:49 COT (-0500)
Show Log