Observation 208456: Amanita submaculata Peck

Proposed Names

28% (1)
Eye3
Recognized by sight
94% (3)
Eyes3
Used references: Happen to agree with Dave’s suggestion, especially with no evidence to the contrary… so far

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Geez, I’ve gotta post some sequences. I thought I had.
By: R. E. Tulloss (ret)
2017-06-23 02:28:38 CEST (+0200)

R

Thanks Rod
By: Stephen Russell (Mycota)
2017-06-22 23:59:22 CEST (+0200)

I think what led me astray morphologically was the even brown cap on the small specimen. There also are not any reference sequences in GenBank. So least now I have a good reference. https://mycomap.com/...

99.9% match to a collection of Amanita submaculata (RET 531-7)
By: R. E. Tulloss (ret)
2017-06-22 22:18:01 CEST (+0200)

The next two closest matches were the same species 99.8% and 99.6% — two haplotype from another collection — (RET 531-6).

Very cool,

Rod

The nrSSU fragment can always be trimmed to 46 characters…
By: R. E. Tulloss (ret)
2017-06-22 22:11:13 CEST (+0200)

…in the middle of the GTAAAAGT substring. Before the 46 character segment, there is overlap with a primer site. Eventually GenBank catches this in a sort of “clean-up operation.” They may remove more than is necessary in my experience. Sorry to repeat if you already were aware of this.

Very best,

Rod

Two days in a row we’re “working together.”
By: R. E. Tulloss (ret)
2017-06-22 22:07:49 CEST (+0200)

I really appreciate being drawn in to these DNA interactions, Steve.

Very best,

Rod

It should be labeled AM143 RET. ITS
By: Stephen Russell (Mycota)
2017-06-22 21:15:59 CEST (+0200)

AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAACGAAAAGGGTGGCAAGGCTGTCGCTGGCTTGAATGAGCATGTGCACGTCTTTTGCTGCTTATTTCATTCTATTTCCACCTGTGCACATTTTGTAGACACTTGGGAATGAGAGGTTGAATTGATTGACCTCTTGATATTGAAAAGTCCGAGTGTCTATGTATTTTTTATATACACAGTTGCATGTCTATAGAATGAGGTTGTAGGCTTTTTTGTAAGCCTTTAAATGATAAAGTATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAGTATCTCAAAAGCTTATGCCTATTTTGTGGCGTGAGACTTTTGGACAATGGGAGTTGCCGGTCACTGATGAAAGTGGTGGGCTCTTCTGAAAAGTATTAGTTGAGGAACTTTGCACTCTATTGGTGTGATAGAATATCTATGCCAGGAGATGCTTTATGATCCTCTGCTGTCTAACTGTCTTCATTGGACAAACATGATGAACTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTA

Just happened to be looking through…
By: Dave W (Dave W)
2017-02-10 20:28:25 CET (+0100)

some of my solaniolens observations. Here’s one with a cap color similar to Stephen’s obs 139729 … also resembles the cap of submaculata. The spore shape for 139729 definitely rules out submaculata (and supports solaniolens). Also, basal bulb on 139729 is on the slim side for solaniolens (maybe not as extreme as for 208456).

So I think 139729 represents additional evidence to suggest that solaniolens may take on the appearance of a slender submaculata.

One thing about this observation (208456) that still makes me wonder is the large superior skirt-like annulus.

Is the read for this collection the one you sent me labeled “NA125”?
By: R. E. Tulloss (ret)
2017-02-02 00:41:51 CET (+0100)

Very best,

Rod

I’m sorry
By: Debbie Viess (amanitarita)
2017-02-02 00:37:06 CET (+0100)

did ya’ll miss the part where the DNA was already done? I am assuming that is what was meant by “having a high quality read.”

Stephen, did this turn out to be a DNA match for solaniolens?

If so, that’s really all the proof that we need, isn’t it?

Basal bulb is really narrow for solaniolens.
By: Dave W (Dave W)
2017-02-01 22:19:22 CET (+0100)

Looks almost like a slender submaculata. Potato odor should immediately single out solaniolens in the field.

great that you already ran the DNA
By: Debbie Viess (amanitarita)
2017-02-01 19:30:50 CET (+0100)

and confirmed this ID, Steve.

here in the west, just about every colored amanita that I know of eventually shows a white form. why should solaniolens be any different?

does make those mere at home photo IDs a bit tricky, tho!

Love to see the read.
By: R. E. Tulloss (ret)
2017-01-24 01:59:53 CET (+0100)

Very best,

Rod

I have a high-quality read
By: Stephen Russell (Mycota)
2017-01-22 21:34:04 CET (+0100)

if you would like to compare.

I’ve never seen it so pale in the U.S.
By: R. E. Tulloss (ret)
2015-07-02 12:46:15 CEST (+0200)

I’d like to check the DNA of this material if that is possible.

Very best,

Rod

Created: 2015-07-02 05:49:28 CEST (+0200)
Last modified: 2017-06-23 02:33:34 CEST (+0200)
Viewed: 158 times, last viewed: 2017-08-08 06:49:59 CEST (+0200)
Show Log