Observation 208478: Psilocybe tasmaniana Guzmán & Watling
When: 2015-04-17
Who: TimmiT
No herbarium specimen

Notes: Heyowana collection (more information here)

Microscopic Observations
Spores:
Elipsoid-ovate in face view, inequilateral in side view, thick walled, avg 10×6µm

Cheilocystidia:
Abundant, forming a sterile band, ventricose-rostrate, occasionally branched, 20-25 × 6-10µm, neck length 5-10µm

Pleurocystidia:
Very rare, similar to cheilocystidia

Basidia:
4-sterigmate, 21-27 × 9-10µm

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
LSU sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-04 05:17:30 CDT (-0400)

TCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTTGCTGGCTTCSTCAAGAGGTCTGCTCCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATGAATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTCTGGCCGTCCGAGTTGTAATCTAGAGAAGTGTTRTCCGCGCTGGACCGTGTACAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGGATCAACCTTGCTTTTGCTGGGTGTACTTTCCGGTTGACGGGTCAGCATCAATTTTGACCGTTGGATAAAGGCTTTGGGAAAGTGGCTTCTTCGGAAGTGTTATAGCCCATGGTCGCATACAACGGTTGGGATTGAGGAACTCAGCACGCCGAAAGGCCGGGTACTTGTACCACGTTCGTGCTTAGGATGCTGGCAT

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-13 20:58:17 CDT (-0400)

TGACTTGGCTCGGTTGCAGCTGGTCCTCTAGAGGGCATGTGCTCGCCGTGTCATCTTTATCTCTCCACCT
GTGCACCTTTTGTAGACCTGGATTAGTTAATTTTCCGAGGAAACTCGGTCGGGAGGATTGCTTTCACAAGCTCTCCTTGC
AATTAACCCAGGCCTACGTTTTCATATACCCCAAAGAATGTAACAGAATGTATTATATTGGCCTTGTGCCTATAAACTAT
ATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCA
GAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATT
AAATTCTCAACCTTACCAGCTTTTGCTGATAATGGCTTGGATGTGGGGGTCTTTTTGCTGGCTTCCTCAAGAGGTCTGCT
CCCCTTAAATGTATTAGCCGGTGCCCCGCGCAGAGCCGTCTATTGGTGTGATAATTATCTACGCCGTGGACCTTTGCATG
AATGGGATTGCGCTGCTTCTAACCGTCCTTCACTGGACAATACAAATGACAATTTGACCTCAAATCAGGTAGGACTACCC
GCTGAACTTAAGCATATCAT

Psilocybe alutacea?
By: Zen Peddler (zen peddler)
2015-07-04 00:11:59 CDT (-0400)

Cystidia could fall within Psilocybe alutacea (almost lageniform) as would strongly striated margin assuming that is a taxonomically significant characteristic.
Although subaeruginosa also has hyaline lageniform c.cystidia.

Created: 2015-07-02 10:10:10 CDT (-0400)
Last modified: 2016-04-13 20:56:44 CDT (-0400)
Viewed: 243 times, last viewed: 2016-11-17 23:36:59 CST (-0500)
Show Log