Observation 208894: Brunneoporus malicolus (Berk. & M.A. Curtis) Audet

Notes:
On a fence post, probably oak. Had a very pleasant mushroom odor which had hints of pine and also smelled sweet.

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Pore measurements?
By: Derek Ziomber (Space Time Matters)
2018-04-18 22:16:14 PDT (-0700)

Did you happen to measure pore size?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 16:07:15 PDT (-0700)

GTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAA

Created: 2015-07-04 22:14:47 PDT (-0700)
Last modified: 2018-04-23 22:50:27 PDT (-0700)
Viewed: 76 times, last viewed: 2018-05-03 04:03:26 PDT (-0700)
Show Log