Observation 208894: Antrodia malicola (Berk. & M.A. Curtis) Donk

When: 2015-07-02

Collection location: Camino viejo a Pacho Viejo, Mpio de Xalapa, Veracruz, Mexico [Click for map]

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
On a fence post, probably oak. Had a very pleasant mushroom odor which had hints of pine and also smelled sweet.

Proposed Names

57% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Based on chemical features: 100% ITS match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 19:07:15 EDT (-0400)

GTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAA

Created: 2015-07-05 01:14:47 EDT (-0400)
Last modified: 2016-05-14 19:12:52 EDT (-0400)
Viewed: 29 times, last viewed: 2017-12-24 14:31:37 EST (-0500)
Show Log