Observation 208894: Antrodia malicola (Berk. & M.A. Curtis) Donk
When: 2015-07-02
No herbarium specimen

Notes: On a fence post, probably oak. Had a very pleasant mushroom odor which had hints of pine and also smelled sweet.

Proposed Names

56% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Based on chemical features: 100% ITS match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 18:07:15 CDT (-0500)

GTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAA

Created: 2015-07-05 00:14:47 CDT (-0500)
Last modified: 2016-05-14 18:12:52 CDT (-0500)
Viewed: 25 times, last viewed: 2017-02-19 17:07:23 CST (-0600)
Show Log