Observation 208896: Antrodia malicola (Berk. & M.A. Curtis) Donk
When: 2015-07-02
No herbarium specimen

Notes: On an oak fence post.

Proposed Names

56% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Based on chemical features: ITS sequence match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-24 00:37:59 CEST (+0200)

GGGTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Created: 2015-07-05 07:20:24 CEST (+0200)
Last modified: 2016-06-23 23:44:17 CEST (+0200)
Viewed: 22 times, last viewed: 2016-12-05 07:41:52 CET (+0100)
Show Log