Observation 208896: Antrodia malicola (Berk. & M.A. Curtis) Donk
When: 2015-07-02
No herbarium specimen
0 Sequences

Notes:
On an oak fence post.

Proposed Names

57% (1)
Recognized by sight
87% (1)
Eye3 Eyes3
Based on chemical features: ITS sequence match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-23 18:37:59 EDT (-0400)

GGGTTGTAGCTGGCGTTCTCGGACGCATTTTGTGCACGCCCTGATCATTATCCATCTCACACCTGTGCACACTCTGTAGGTCGGTTACTGGGGCTACTGTCTTTATTGGTGGTGCTCTGTGGCCTTCCTATGTTTTTATACAAACTACTCAGTTTAAAGAATGTCAATTGCGTGTAACGCATTTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTATTTGTGAATAGGGCTTGGACTTGGAGGTTTTGAATGCTGGATACTACTTTGTATTCAGCTCCTCTTAAATGCATTAGCTCGAGCCTGTTGTGGATCAGCTTCAGTGTGATAATTGTCTACGCTGTTCTGTGAAGCATTATTATATATGGGCCTTCGGCTTCTAATTGTCCTGTACTGGACAACATCTATGACCTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Created: 2015-07-05 01:20:24 EDT (-0400)
Last modified: 2016-06-23 17:44:17 EDT (-0400)
Viewed: 31 times, last viewed: 2017-11-03 18:22:52 EDT (-0400)
Show Log