Observation 208897: Fuscoporia gilva (Schwein.) T. Wagner & M. Fisch.

Notes:
Growing on a fallen trunk of a wild avocado tree.

Species Lists

Images

535058
DSC_3202.JPG
535059
DSC_3203.JPG
535060
DSC_3204.JPG
617635
535060-2.jpg
617636
fuscoporia-tree.jpg
617695
fuscoporia-bootstrap.jpg
A tree with midpoint rooting and bootstrap support

Proposed Names

11% (2)
Recognized by sight
47% (3)
Eye3 Eyes3
Based on chemical features: ITS sequence match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Alan, did she mean it is common everywhere,
By: Judi T. (AvidAmateur)
2018-04-17 20:05:15 CDT (-0500)

including N. America? I sure would love to come across that pore surface on the F. gilva I find so often.

Then it
By: Chaelthomas (Chaelthomas)
2018-04-17 17:29:54 CDT (-0500)

Must just be a variation which is more common then not. It’s good to have all examples of growth.

Spoke with Tatiana Gibertoni
By: Alan Rockefeller (Alan Rockefeller)
2018-04-17 15:50:43 CDT (-0500)

Who is working on this group. She said it is common for them to look like this, and it is F. gilva in her opinion.

It probably is a subspecies or variety
By: Alan Rockefeller (Alan Rockefeller)
2018-02-23 21:40:07 CST (-0600)

I have generated hundreds of sequences and none of the other ones got mixed up for any reason.

I do feel
By: Chaelthomas (Chaelthomas)
2018-02-23 13:29:41 CST (-0600)

Like it could be a subspecies or variety. A lot of stuff on genbank is hit or miss and it may be time to pull out the scope and compare a few samples from different regions.

Thanks for taking time, Alan, to explain all
By: Judi T. (AvidAmateur)
2018-02-23 09:40:11 CST (-0600)

the possibilities for me. Such an intriguing mystery and certainly worthy of further investigation. I look forward to learning what you discover this summer about your fascinating specimens. Thanks again!

What does it mean?
By: Alan Rockefeller (Alan Rockefeller)
2018-02-23 01:57:56 CST (-0600)

Maybe this species is more variable than thought….Or maybe two closely related species have the same ITS sequence. Neither of those things are very likely. Maybe I switched the samples accidentally, or made a typo or pipetting error. Those two things are more likely. I have the dried collection, and will photograph and scope it when I see it – and verify the numbers written on the bag match the tube #‘s with the frozen DNA. I can also verify that the spores in the frozen DNA match the dried material, so I know that I didn’t put the wrong mushroom into the wrong tube at the beginning of the DNA sequencing process. Careful study of more samples from this location will be interesting – I’ll be back there this summer.

Alan, such an interesting Ob. Permit me please
By: Judi T. (AvidAmateur)
2018-02-20 18:35:51 CST (-0600)

an earnest question, and keep in mind I know very little about DNA sequences. How can this be a match for F. gilvus and have a maze-like fertile surface … so different from the tiny, round pores we are used to seeing on this species? Is this a new variant? I am so curious as to what this means.

Hmmm
By: Chaelthomas (Chaelthomas)
2018-02-19 03:34:08 CST (-0600)

Hmmm

It looks slightly different.

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 14:55:16 CDT (-0500)

ACGCTTGAGCTGGCATTGCAGGTGCTCGGCGTCTCCATTCATTCCAATTCAAACACCTGTGCACCTCGAG
AACGTGAGTTGGGTTATTGGATCTGTGGTTCATTTATTCCCTTATTTGGGTTGAACTTAGTGAAAGTGCC
CGCTTTCGTTTCTTATTACAAACTCGTTATATTGTTTTGTAGAATGTATCGCCTTTAAATAGGCAAAGTC
TAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGT
AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGG
AGCATGCCTGTTTGAGTGTCATTATGTACTCAACTCCCTTGATTTTTTTAATAAAATCATTCGAGTTGGA
TTTGGAGGTTCTTCATGCTGGTCCTCGCGGATCGGCTCCTCTCAAATGCATTAGCTGAGCTTTCGCTTGA
TGCAATGGTGTAATAATTATCTTCACCGATGCAACTAGTGATATAGGCTTGCTTCTAATCGTCTCCTATC
CGAGACATTATAAAAGATAAACCCTTTTCGGGGGGAGACTCTTTTTGACTCTTCTGACCTCAAATCAGGT
AGGATTACCCGCTGAACTTAAGCATATCA

Created: 2015-07-05 00:24:25 CDT (-0500)
Last modified: 2018-04-17 20:05:16 CDT (-0500)
Viewed: 214 times, last viewed: 2018-04-18 23:42:45 CDT (-0500)
Show Log