Observation 208897: Fuscoporia gilva (Schwein.) T. Wagner & M. Fisch.
When: 2015-07-02

Notes: Growing on a fallen trunk of a wild avocado tree.

Species Lists

Images

535058
DSC_3202.JPG
535059
DSC_3203.JPG
535060
DSC_3204.JPG
617635
535060-2.jpg
617636
fuscoporia-tree.jpg
617695
fuscoporia-bootstrap.jpg
A tree with midpoint rooting and bootstrap support

Proposed Names

56% (1)
Recognized by sight
58% (1)
Eye3 Eyes3
Based on chemical features: ITS sequence match

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 12:55:16 PDT (-0700)

ACGCTTGAGCTGGCATTGCAGGTGCTCGGCGTCTCCATTCATTCCAATTCAAACACCTGTGCACCTCGAG
AACGTGAGTTGGGTTATTGGATCTGTGGTTCATTTATTCCCTTATTTGGGTTGAACTTAGTGAAAGTGCC
CGCTTTCGTTTCTTATTACAAACTCGTTATATTGTTTTGTAGAATGTATCGCCTTTAAATAGGCAAAGTC
TAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGT
AATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGG
AGCATGCCTGTTTGAGTGTCATTATGTACTCAACTCCCTTGATTTTTTTAATAAAATCATTCGAGTTGGA
TTTGGAGGTTCTTCATGCTGGTCCTCGCGGATCGGCTCCTCTCAAATGCATTAGCTGAGCTTTCGCTTGA
TGCAATGGTGTAATAATTATCTTCACCGATGCAACTAGTGATATAGGCTTGCTTCTAATCGTCTCCTATC
CGAGACATTATAAAAGATAAACCCTTTTCGGGGGGAGACTCTTTTTGACTCTTCTGACCTCAAATCAGGT
AGGATTACCCGCTGAACTTAAGCATATCA

Created: 2015-07-04 22:24:25 PDT (-0700)
Last modified: 2016-05-14 20:32:45 PDT (-0700)
Viewed: 51 times, last viewed: 2016-12-09 09:35:11 PST (-0800)
Show Log