Observation 209052: Amanita arocheae Tulloss, Ovrebo & Halling
When: 2015-07-03
( 1800m)
No herbarium specimen

Notes: The same mushrooms as http://mushroomobserver.org/208878.

The cap turns bright yellow in KOH.

Quercus and Fagus were the nearby trees.

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
hi Dave
By: Debbie Viess (amanitarita)
2016-05-19 18:07:49 UTC (+0000)

or perhaps it is more of a bacterial contamination thing?

certainly getting amanitas to sp. through their DNA is not always smooth sailing.

Not sure if this applies here…
By: Dave W (Dave W)
2016-05-19 03:16:45 UTC (+0000)

I submitted some Destroying Angels to Rod a couple years ago which failed to yield usable DNA data. The reason appears to have been that these large fruit bodies were “pre-dried” by hanging in a south-facing attic window for a couple days (before I put them into the dehydrator). Evidence suggests that DNA data may be difficult to extract from Amanitas dried at too low a temperature.

strange perhaps, but true.
By: Debbie Viess (amanitarita)
2016-05-18 23:07:56 UTC (+0000)

that was a long time ago, in a far away place.

yup, it was the Lepidellas that have proven to be so difficult. Now it sounds like some of those (the non-MR ones) might get pulled outta Amanita altogether.

Rod talked about that in one of his amanita talks at NAMA recently.

Again, DNA analysis not my thing. But I do get where it is useful in combination with all of the rest. Still, if you end up needing DNA every time to know what you have, not practical in the short term or the field, and expensive, to boot, unless you have funding or a friend at University. Having field tri-corders would take all the FUN outta those name discoveries. We are probably a long way from that, at least in a price point where the average Joe or Jill could use ’em. And then you have to hope that the DNA on file, to which you are matching your brand new sample, actually represents the mushroom that it claims to be! As you know, that is not always true.

AT any rate, we live in interesting times, both good and bad.

Unlikely
By: Alan Rockefeller (Alan Rockefeller)
2016-05-18 20:32:34 UTC (+0000)

I find it hard to believe that Anne Pringle had trouble distinguishing Amanita vernicoccora from A. calyptroderma using DNA sequences. I just made a quick tree of the caesareae and the difference is easy to see, with both species forming well supported clades. http://images.mushroomobserver.org/Caesareae.jpg

It is not hard to sequence Amanitas, all that I have tried worked except for one Lepidella. The matches, when they are available have been nearly perfect.

funny.
By: Debbie Viess (amanitarita)
2016-05-18 15:33:19 UTC (+0000)

there seems to be quite a bit of angst at running amanita DNA at University level, with many failures and meaningless data. Hell, even Anne Pringle at Harvard had difficulty distinguishing the DNA of vernicoccora from calyptroderma, at least at first. And she is about as bright as one gets, with Harvard equipment!

The difficulties with amanita sequence apparently continue. Not sure what you do differently.

100% matches are certainly what I like to see for my good matches to species!

We’ll see how this all plays out over time. It certainly makes sense that arocheae is similar to other members of section Phalloideae, but close is no cigar.

It is also interesting that arocheae turns bright yellow in KOH, like a Destroying Angel rather than a phalloides (Death Cap)! All of these unique arocheae attributes lend credence to our ability to call this species w/out any DNA at all.

Sometimes, a more naturalistic vs DNA lab approach does work, IMO.

No delayed bite
By: Alan Rockefeller (Alan Rockefeller)
2016-05-18 10:46:02 UTC (+0000)

Most Amanitas are pretty easy to sequence, they work more often than average for me. It’s the mushrooms with lots of pigments like Cortinarius and Inocybe that are harder to sequence due to PCR inhibitors.

Usually there isn’t much variation in a species – the barcode I get usually matches 100% if it is the same thing. Sometimes there are a couple base pairs off, half the time this is a sequencer or PCR error.

A 1.6% difference is usually enough to say that it’s not the same thing, if both sequences being compared are good quality. The exact cutoff is subjective, as it should be – morphological features should be weighed as well when deciding species boundaries.

mild …
By: Debbie Viess (amanitarita)
2016-05-17 20:40:04 UTC (+0000)

with a delayed bite?

I understand getting good DNA info from amanita sp. is problematic at best, even for those at University, with top notch equipment.

How many collections of arocheae are in NA herbaria, ready to be tested? How much variation is there within a species, anyway? Does it vary from sp. to sp.?
By how much? Don’t we need to take ALL of the characteristics into account, not just one or two?

It seems as though we do have a macro-morph species concept for this, even w/out the DNA.

The NE Destroying Angel proposed name amerivirosa (with limited online data) is certainly not this obvious and well known in its area death cap, regardless of DNA data. Nor is it the CR very slender stiped, pale, rather ragged-capped Death Cap that you cited, which has unique macro-morph features.

Some would say a difference of only 1.6 could make it the same species. Where do we draw the line on amanita DNA comparisons? Only 100% = a true match?

And the so-called amerivirosa is identical to bisporigera, down to the micro! It fooled Rod, and if it can fool Rod …

Even Psilocybe allenii differed in two regards from P. cyanescens: macro and DNA
(but not micro).

What I am hearing is that there aren’t really any close morpho matches to arocheae in Mexico/SA. But carry on.

I look forward to more info posted here.

Flavor was mild
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 20:03:36 UTC (+0000)

Regarding this sequence, Rod Tulloss said "I have two closer matches than GenBank provided: “sp-CR14” (from Costa Rica, 1.5% genetic distance) and “amerivirosa” (from eastern North America, 1.6% genetic distance and the same thing as Yang’s sp. 1, which was based on my material). What you have is too distant to be a good match to either of these. "

He is working on sequencing his Amanita arocheae collections, but right now there aren’t any A. arocheae sequences to compare with.

do we suspect cryptic sp. in the Mexican/SA death caps?
By: Debbie Viess (amanitarita)
2016-05-17 17:31:49 UTC (+0000)

I have never seen this sp. in the flesh, but it (our macro-morpho concept of arocheae) looks to have a unique attribute: a radial cracking of the pileus at the cap edge, much like we see in A. brunnescens.

You show another arocheae obsie with this feature here on MO, Alan. Perhaps our Mexican colleagues on MO could chime in with their observations?

how did they taste?
By: Debbie Viess (amanitarita)
2016-05-17 17:02:47 UTC (+0000)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 15:20:27 UTC (+0000)

AGGCTGTCGCTGGCCCACCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACTTGTGCACACTTGTAGACACTTGGGAATGAGAGACTTTGACCAGTCTCTTGAGAGAATCAAATCTGGGTGTCTATGCCATTTTATTACACACTAGTTGCATGTCTATAGAATGATAATTTGATTAAATATAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCTGAGGAGCATGCCTGTTTGAGTGTCATTAACATCTCAAGACCTGTCTGCTTTTGATAGGTATTGGATTTTTGGGGGTTGCAGGCTGTTTCAGCTTGCTCTCCTTGAATGTATTAGTGGAGAAAGAGCCATTGAACTCCATTGGTGTGATAAAATTTATCAATGCCAGGAGCCATGTTAGTTCTCTCTGCTGTCTAACCCTAACAGTTGTCTGTAAAAAATAGACAACTCAACCTAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Created: 2015-07-06 18:27:47 UTC (+0000)
Last modified: 2016-05-17 17:15:40 UTC (+0000)
Viewed: 107 times, last viewed: 2016-10-16 01:08:24 UTC (+0000)
Show Log