Observation 209054: Boletales E.-J. Gilbert

Notes:
Under Quercus and Fagus.

Species Lists

Images

535537
DSC_3357_2.JPG
535538
DSC_3360_2.JPG
870422
Screenshot from 2018-05-16 02-29-38.png
Email from Roy Halling regarding this collection

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Alan,
By: I. G. Safonov (IGSafonov)
2018-05-15 11:36:33 CDT (-0500)

I am not getting any Retiboletus hits with your sequence in GenBank. The highest similarity is below 90% and the hit pattern doesn’t make any sense. I’ve trimmed away the LSU fragment (ITS2 ends with GAAAC), but that hasn’t changed anything. Any ideas?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 10:59:42 CDT (-0500)

TGTGCACGTCGACCTTTTAACTCTACACACCTGTGCACCTGTTGTAGGTCCTCGAAAGAGGATCTATGTTTTTCATAATCACACCTATCGTATGTCTATGGAATGAATGTAATCGAGATATAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTGAATTCTCAACCATGCCCCCCTTTTGAAGTGGGGGGCATTGGCTTGGAGTTGGGAGTTTGCTGGTAGTGAAGGCTTGTCAGCTCTCCTGAAATGCATTAGTGTGAGAGACGTGCACGGCCTCCGACGTGATAATGATCGTCATGGCTGGAGCGTTTTGAGACCATGCCCAATGATATTTTGAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAG

Created: 2015-07-06 13:57:43 CDT (-0500)
Last modified: 2018-05-16 10:45:31 CDT (-0500)
Viewed: 92 times, last viewed: 2018-05-16 19:19:19 CDT (-0500)
Show Log