Observation 209069: Clavulina J. Schröt.
When: 2015-07-03
( 1800m)
No herbarium specimen

Notes: Under Quercus and Fagus.

Proposed Names

56% (1)
Recognized by sight
65% (2)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-18 03:21:11 CST (+0800)

ATGGGGGTTTGATGCTGGCTGTCATCCTTTTGGCTGCATGTTGCTCGCCCTCAGCAATCCTTTTCCAAACACCTGTGCATCTTGTGAGTTCGAGGAAGGGGGAACTCTTTCTTGTCTCATGATTCATAAACGCCGCCTGTAAATATTGAATGCTGTTCGTGCCGTTAAGGCCTTAACCATAATACAACTTTTGACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGAGAGTACGCCTGTTCGAGTGTCGTGAAACTGTCAAGCTAGGATGCGCTTTTCCTGGCTTGGTTTGTTGGGCTTTTGCCGGTGTCCTTTCACTAGGGAACGGGCTGGCCTTAAAAGTATTAGCTGACTCCATGTGGTTATTGGTTTTCTACTCGGCGTGATAATTAGATGACCGCCGGGAAAGTGTCCCTCTGGGGATCGCCAATTTTCATCTGGGTTGCTTCTAATCTTGGAGCTTCGGTTCCATTTGTTCAACTTTGACCTCGAATCAGGTGGGACCACCCGCTGAACTTAAGCATATCAATA

Created: 2015-07-07 04:36:41 CST (+0800)
Last modified: 2016-05-18 03:33:45 CST (+0800)
Viewed: 39 times, last viewed: 2016-05-18 22:12:21 CST (+0800)
Show Log