Observation 209089: Mycena sect. Sacchariferae
When: 2015-07-05
( 1600m)
No herbarium specimen

Notes: Growing on pine and oak debris, most commonly pine needles. The same species as http://mushroomobserver.org/176990.

Species Lists

Images

535820
DSC_3689_1.JPG
Alonso was using a red LED flashlight off to the side
535678
DSC_3535_1.JPG
535813
DSC_3618_1.JPG
waiting for it to get dark
535814
DSC_3627_1.JPG
Very blair witch
535815
DSC_3638_1.JPG
535816
DSC_3649_1.JPG
long exposure with LED light
535817
DSC_3653_1.JPG
with ring flash
535818
DSC_3685_1.JPG
535819
DSC_3688_1.JPG
535821
DSC_3697_1.JPG
535822
DSC_3704_1.JPG
535823
DSC_3705_1.JPG
535824
DSC_3726.JPG
spore prints
535825
DSC_3730.JPG
Hunting for bioluminescent mushrooms
535826
DSC_3733.JPG
Hunting for bioluminescent mushrooms
535830
DSC_3519_1.JPG
617815
result (8).jpg
ITS phylogenetic tree, with very low bootstrap support

Proposed Names

14% (3)
Recognized by sight: Mycena sp & primordia M. spinosissima

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank KY989966
By: Alan Rockefeller (Alan Rockefeller)
2017-05-07 04:52:20 CDT (-0500)
GenBank KY989966
By: Alan Rockefeller (Alan Rockefeller)
2017-05-07 04:52:19 CDT (-0500)
Probably 30 seconds
By: Alan Rockefeller (Alan Rockefeller)
2016-05-16 02:12:34 CDT (-0500)

You can find out for sure by copying the URL of my original images, then pasting them into http://regex.info/exif.cgi. This allows you to see all the EXIF data.

Delightful images
By: Martin Livezey (MLivezey)
2016-05-15 20:41:57 CDT (-0500)

Do you remember the approximate exposure times?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-15 13:48:56 CDT (-0500)

GTGTTGATGCTGGCGTGAAGCGCATGTGCTCGCATTCATTTTATTTCAAATCCCTTTGTGCACCTTTCTAGTCTCGAATTCGAAAAGGAACCTCTCACACTTGATCACCTATTTTCTCTGGGTAAACCGGAGGCGTTGGGTCGCTTGAGCACTTTCATTAGTGTCCTATGATCCTTTGTTCTTGAACGTGGGTTTGAAGTGATTGAACCGTGTAAAAAGCGGTACTTGCTTCTATGTCAGCAGTATGGTTCGGACTAGCTTTTATATCTCTATTGTATGTTAAAGAATGTCATCTTTGTTGACGAAAGTCAATAAAAAACCTATACAACTTTCAGCAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTACAACTTTATTGTTGTAAGGCTTGGATGTGAGGGTTATTGCTGGCTTCCTTCANTGCGATGGTCAGCTCCCTTTAAATGCATTAGTGGAATTCTTGTGAATCGTTCACTGAGTGTGATAATTATCTACGCTCTAGATTTGCAAAGTCTGCTTATAACCGTCCTTCAGTTGGACAATTTATTGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATA

Created: 2015-07-06 20:22:07 CDT (-0500)
Last modified: 2016-05-15 14:13:08 CDT (-0500)
Viewed: 168 times, last viewed: 2017-08-09 00:12:18 CDT (-0500)
Show Log