Observation 209090: “Discomycetes” Sacc.

When: 2015-07-05

Collection location: Bosque Oreomunea, Veracruz, Mexico [Click for map]

1600m

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
On hardwood.

Proposed Names

85% (1)
Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-14 19:38:46 EDT (-0400)

CCGCCGTACGTGCCGGGCGTACGCGTCCGGTATCTACGGCGGGGGGCTGTAGAGATAACCACACCCGTGT
ATAGCCTACTCTTGTTGCTTTGGCAGGCCGTGGTCTCCACTGTGGGCTTTGCTCACACGTGCCCGCCAGA
GGATTTAATTCTGAATATTGGTGTCGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCT
TGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCA
TCGAATCTTTGAACGCACATTGCGCCCGGTGGTATTCTGCCGGGCATGCCTGTTCGAGCGTCATTGTGAC
CAATCAAGCTCGGCTTGGTGTTGGGTCCGCGGAATCGCGGTCCTCAAATCTGGTGGCGGTGCCATTGGGC
TCTAAGCGTAGTAAATGCTCTCCCGCTATAGAGTTCCTCTGGTAGCTTGCCAGAACCCCCCACTTTCTAC
GGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

Created: 2015-07-06 21:25:14 EDT (-0400)
Last modified: 2015-07-07 01:55:54 EDT (-0400)
Viewed: 39 times, last viewed: 2017-12-21 01:39:14 EST (-0500)
Show Log