Observation 209526: Amanita bisporigera G.F. Atk.
When: 2015-07-07
No herbarium specimen
0 Sequences

Notes:
Under oak.

Images

536989
DSC_3765.JPG
536990
DSC_3767.JPG
536991
DSC_3768.JPG
536992
DSC_3769.JPG
536993
DSC_3770.JPG
536994
DSC_3771.JPG
536995
DSC_3772.JPG
536997
DSC_3773.JPG
Habitat

Proposed Names

-29% (1)
Recognized by sight: Pure white, small and gracile.
Based on chemical features: KOH immediately bright yellow on cap
92% (2)
Eye3 Eyes3
Based on chemical features: 100% ITS match with https://www.ncbi.nlm.nih.gov/nucleotide/744437974 and https://www.ncbi.nlm.nih.gov/nucleotide/1006164899, and essentially the same as several other RET A. bisporigera vouchers

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF062567
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 07:24:11 CDT (-0400)
Hello, Alan.
By: R. E. Tulloss (ret)
2017-05-08 08:57:22 CDT (-0400)

You presented a very nice case.

Very best,

Rod

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-05-07 04:02:41 CDT (-0400)

TCGAGGCTGTCGCTGGCCCATCTGGGCATGTGCACGTCTCTGGTCATTACCAATTCCACCTGTGCACACT
TGTAGACACTTGGGAATGAGAGACTTTGACCGGTCTCTTGAGGGAATTGAACTCTGGGTGTCTATGCCAT
TTTATCAAACACTAGTTGCATGTTTATAGAATGACGATTTGATTGAATATAAAATACAACTTTCAACAAC
GGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCA
GTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGCATTCCGAGGAGCATGCCTGTTTGAGTGTC
ATTAACATCTCAAGACCTGTCTGCTTTTGATAGGTATTGGATTTTGGGAGTTGCAGGCTGTTTCAGATAT
AGCTTGCTCTCCTTGAATGTATTAGTGGAGAAAAGCTGTTGAACTCCATTGGTGTGATAAAATCTATCAA
TGCCAGGAGCAACGTCGAGTTGTCTCTGCTGTCTAACCCTAACTGTCTGACCCACTTGACCTCAAATCAG
GTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAAGGATC

Microscopy
By: Alan Rockefeller (Alan Rockefeller)
2015-07-14 11:59:10 CDT (-0400)

The basidia were 75% four spored and 25% two spored, and contained large oil droplets.

Created: 2015-07-10 22:24:40 CDT (-0400)
Last modified: 2017-05-07 08:29:12 CDT (-0400)
Viewed: 72 times, last viewed: 2017-11-18 00:30:56 CST (-0500)
Show Log