Observation 209527: Russula Pers.

When: 2015-07-09

Collection location: El Zapotal, Veracruz, Mexico [Click for map]

19.508° -97.0147°

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
This Russula species is always very tiny and always on well decayed wood. The max cap size is about 1.5 cm.

Found in a forest of mixed Quercus and Oreomunnea mexicana about 2 km below El Zapotal.

Species Lists

Images

739414
536998-2.jpg
536996
DSC_3786.JPG
536998
DSC_3791.JPG
536999
DSC_3794.JPG
537001
DSC_3796.JPG
537003
DSC_3797.JPG

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
GenBank MF067426
By: Alan Rockefeller (Alan Rockefeller)
2017-05-19 05:07:44 PDT (-0700)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2017-05-07 02:03:49 PDT (-0700)

GCCAGGGCTGTCGCTGATCTTCCAGGGTCGTGCACGCCCGGGTGCTCTCGCTCAATCCATCTCACCCCTTTGTGCATCACCGCGTGGGTCCCCCCTTTGCAGGGAGGGCTCGCGTTTTCACATAAAACTTGATACAGTCTAGAATGTTTATTTTTGCGGTTGCACGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGCATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAACCCTCAAAACCCCTTTTTCTTTCACCGGAATGGGGGATTTTGGACTTGGAGGTTCGATGCTCGCTTTCGAAAGCAAAAGCGAGCTCCTCTTAAATGAATCAGTGGGGTCCGCTTTGCCGATCCTTGACGTGATAAGATGTTTCTACGTTTTGGATCTGGCACTGTTTTCTCTGCTTCTAACCGTCTCATCGACAAAAGATGGTGCTTCGGTCCCTGTCATCTACGTTGGCGGGAGGCTGGACCCACAAAGAAAAACCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTAAGCATATCAATAAG

Created: 2015-07-10 19:25:37 PDT (-0700)
Last modified: 2017-05-19 05:07:20 PDT (-0700)
Viewed: 36 times, last viewed: 2017-12-21 10:32:41 PST (-0800)
Show Log