Observation 209529: Psilocybe yungensis Singer & A.H. Sm
When: 2015-07-09
(19.508° -97.0147° )
No herbarium specimen

Notes: Found two miles below the tiny community of El Zapotal.

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight: Growing on very well decayed hardwood. Very thin cap, dark squamulose stipe in age.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 12:41:31 PDT (-0700)

GACTTGGCTTGGTTGTGCTGGTCCTTTCGAGGACATGTGCATGCCTTGTCATCTTTATCTATCCACCTGTGCACCTTTTGTAGACTTGGTTATAGTGAACGGGAGGGCATGCTCTCCTTGTAGCTATACTAAGCCTATGTTTTACATACCCCAAAGAATGTAATAGAATGTATTGTATGGCCTTGTGCCTATAAATCATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTTGACAGCTTTTGCTGTTAATGGCTTGGATGTGGGGGTCTATTTTGCTGGCTTAGGTCGGCTCCCCTCAAATGTATTAGCCGGTACCCTGCGCGGAGCCGTCTATTAGTGTGATAATTATCTACGCTGTTAGACCTCTGCATTAATGGGATTGTACTGCTTCTAACCGTCCTCTTGGACATATAATGACAATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAA

Created: 2015-07-10 19:34:01 PDT (-0700)
Last modified: 2016-10-23 21:31:41 PDT (-0700)
Viewed: 39 times, last viewed: 2016-10-25 19:59:52 PDT (-0700)
Show Log