Observation 209864: Leccinum luteum A.H. Sm., Thiers & Watling
When: 2015-07-12

Notes: > These young specimens were collected by J. L. Smithson of NJMA at the club foray.
> Habitat: oak, hornbeam and ash.
> The caps are less than 1" in diameter, without the sterile flap (so not in sect. Leccinum) and are yellow, somewhere between oac811 and oac812; the surface is slightly corrugated and staining/bruising brown.
> The pore surface and tubes are concolorous, pale yellowish-tan, and bruising brown.
> The stipes are dingy white, covered with black scabers; the surface bruised blackish when handled.
> The cap context is dingy yellow below the cuticle and whitish elsewhere, staining reddish/ reddish-brown quickly and eventually resolving to blackish.
> No chemical tests were performed.
> The basidiomata turned completely dark brown / black in the dehydrator.
> This material has been preserved for M. Kuo.

DNA Data & Discussion (Jan-23-17):
> A 1389 bps nrLSU sequence has been obtained for this material. This sequence is shorter than usual – the first 50-55 nucleotides that immediately follow the end of nrITS (including the LR0R primer) are missing in this case.
> A GenBank BLAST search of the full-length sequence did not return any meaningful results, not even a single Leccinum sp.
> A BLAST search of a sequence fragment (the first 902 characters) returned more meaningful results, though there were no close hits. The first three top hits were scarber stalks:
1) Leccinum aff. griseum (collected in Japan), accession #JN378509 (866/887 = 97.6% similarity; including 9 gaps)
2) Leccinum aff. griseum (collected in Japan), accession #JN378508 (856/877 = 97.6% similarity; including 9 gaps)
3) Leccinum carpini, accession #AF139691 (851/884 = 96.3% similarity; including 8 gaps)
The greater majority of the remaining 97 sequences were sequestrate Rossbeevera species with similarities in the 94-95% range.
> A separate BLAST search targeting only the GB sequencing data associated with Leccinum explained why so few showed up in the general search. While the top three hits were the same as above and the 4th one was Leccinum rugosiceps at ~95%, everything else was below 93%.

Discussion: Leccinum griseum is now known as Leccinellum griseum (Index Fungorum) and Leccinum pseudoscabrum (MO). Leccinum carpini is also synonymous with Leccinum pseudoscabrum (IF/SF, Mushroom Expert, and MO). While this synonymy is confusing and contradictory, the fact that MO209864 is more closely related to these taxa than any other scaber stalks based the preliminary molecular data is supported by the gestalt morphology of this collection.
Smith & Thiers (1971) placed L. luteum in subsection Luteoscabra (together with Leccinellum crocipodium, Leccinum rugosiceps); they placed L. griseum in subsection Albella with Leccinellum albellum. In addition to this, the European Leccinum pseudoscabrum, with its prominently corrugated cap, looks more like Leccinellum crocipodium and the NA L. rugosiceps and grows under hornbeam. MO209864 was also found in the vicinity of hornbeam.
Finally, phylogenetic analysis by Wu et al. (2014 & 2016) shows that Rossbeevera is more closely related to Leccinellum than Leccinum.
So, what’s the significance of this confusing array of circumstantial evidence? Well, while the identity of MO209864 is still very much a question, it appears to be more closely related to Leccinellum than the core Leccinum based on the LSU sequence alone. The genetic data also points toward it possibly being a unique lineage within the subfamily Leccinoideae. Without sequencing Smith’s holotype of L. luteum and with some of the L. luteum vouchers stored at NYBG, calling MO209864 this name is still very much a conjecture. M. Kuo treats this entity as an uncertain taxon — see http://www.mushroomexpert.com/leccinum_uncertain.html.

Images

537979
Photographed in late afternoon, several hours after harvesting
537980
Photographed in late afternoon, several hours after harvesting
537981
Exposed context staining almost immediately; reddish-brown color intensifying over several minutes
538314
Copyright © 2015 J. L. Smithson
Photo by J. L. Smithson taken shortly after harvesting
538315
Copyright © 2015 J. L. Smithson
Photo by J. L. Smithson taken shortly after harvesting
538316
Copyright © 2015 J. L. Smithson
Photo by J. L. Smithson taken shortly after harvesting
538317
Copyright © 2015 J. L. Smithson
Photo by J. L. Smithson taken shortly after harvesting

Proposed Names

28% (1)
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
DNA sequencing discussion posted
By: I. G. Safonov (IGSafonov)
2017-01-23 19:36:01 PST (-0800)
nrLSU sequence MO209864
By: I. G. Safonov (IGSafonov)
2017-01-23 15:21:12 PST (-0800)

> nrLSU sequence MO209864/Leccinum luteum:
TCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTTGAATCTGGCGGTCATTTTTTAGGCCGTCCGAATTGTAATCTAGAGAAGCGTCTTCCGCGCTGGCCCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCCAGTGCTTATGTGTTGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGACGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTTGATTAGGGATCAGCCTAGCTTAATTTGCTTGGTGTAATTCCTAGTTGATGGGTCAGCATCAGTTTCGGTTAGTGTACATAGGCGAAGGGAAAGTAGCACTCTTTAGGGAGTGTGTTATAGACTCTCGTCGGATGCATTGGTTGGGACTGAGGAACTCTGCACGGATTAAGTTTTGTTGCAAGGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCATGCGAGTGTTTGGGTTTGCAAACTCGAGCGCGTAATGAAAGTGAAAGTTGAGATCTCTGTCATGGAGAGCATCGACGCCCGGACCTGACGTCTTCTTGACTAGGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATATTGATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTCGAAACGACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTGACATTTTGGACCGCTCGGCGATTGAAGAGTTTTTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCCTCAGCGTTAAAGTGACGCGCTGAGGAGTAGGCAGGCGTGGAGGTAGTGAAGAAGCCTTGGCAGCAATGCTGGGTGGAACTGCCTCTAGT

Brian,
By: I. G. Safonov (IGSafonov)
2015-07-14 09:47:41 PDT (-0700)

Thank you for suggesting L. luteum for this collection.
Initially, I have considered proposing this name myself when I was poring over the literature, but then opted to call this one just Leccinum Gray.
True, L. luteum has a yellow cap and is known to be mycorrhizal with hornbeam (Smith & Thiers), which was one of the trees present in the area according to the collector’s notes. Furthermore, the picture of Roy Halling’s collection of L. luteum posted on M. Kuo’s page dedicated to uncertain Leccinum taxa (http://www.mushroomexpert.com/leccinum_uncertain.html) is almost a dead-ringer for the material in this obs. And yet…
The description of L. luteum in Smith & Thiers’ The Boletes of Michigan is a mix of matching and mismatching morphology (I didn’t do any microscopy), and that’s why I was so hesitant to propose the name even with “could be” confidence. In particular, the color of the pore/tubes and the staining of exposed context doesn’t match. However, the BRB description of the species, which I read only now, is a better match for those properties that didn’t fit with Smith & Thiers: “context staining pinkish gray (avellaneous) to pinkish brown and eventually dark brown when exposed; pore surface becoming olive-buff at maturity”.
Hence, I am changing the name for this obs by adjusting the vote confidence.

Created: 2015-07-12 20:34:40 PDT (-0700)
Last modified: 2017-02-27 16:05:13 PST (-0800)
Viewed: 128 times, last viewed: 2017-09-01 17:11:37 PDT (-0700)
Show Log