Observation 210612: Rickenella fibula group
When: 2015-07-18
No herbarium specimen

Notes: On hardwood.

Proposed Names

29% (1)
Recognized by sight: Hirsute stipe, with moss
87% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 13:19:47 CDT (-0500)

TTGAAGTGGGTTTGATGCTGGCCTGCGTAACACCAGGCATGTGCTCGCCCCGCTCATCCACTCAACACCTGTGCACCTTTGAGGCAATTTGCCCTCCATTAACTTGGAGCCGTTCCCTTGGCTTTCACGAGCTGAGGTTGAGCCGGGGCGAATTGTTTCACTTTACACATMACCCATTAAAAGTTTAGTAGAATGTAACCGCCGTTAAGGCAAAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTCTTCTTGCTTTGCGGCTCGAAGTAGGCTTGGATTTGGGAGCTTGCTGGTTTAACAATCGGCTCTCCTTGAATGTATTAGCTGGACTTTCCGATTTAATAGCGGTTCACGGTGTGATAACTATCTACGCCTGGTAAATCCGTCTTTGAGTCTGGTCGAGCTTCTAATCAGTTCGTCCTTTTTGGACAAACACTTTTAAGATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAA

Created: 2015-07-19 03:10:53 CDT (-0500)
Last modified: 2016-05-17 13:45:43 CDT (-0500)
Viewed: 33 times, last viewed: 2016-10-22 11:58:04 CDT (-0500)
Show Log