Observation 210612: Rickenella fibula group
When: 2015-07-18
No herbarium specimen

Notes: On hardwood.

Proposed Names

29% (1)
Recognized by sight: Hirsute stipe, with moss
87% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-05-17 20:19:47 CEST (+0200)

TTGAAGTGGGTTTGATGCTGGCCTGCGTAACACCAGGCATGTGCTCGCCCCGCTCATCCACTCAACACCTGTGCACCTTTGAGGCAATTTGCCCTCCATTAACTTGGAGCCGTTCCCTTGGCTTTCACGAGCTGAGGTTGAGCCGGGGCGAATTGTTTCACTTTACACATMACCCATTAAAAGTTTAGTAGAATGTAACCGCCGTTAAGGCAAAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTCTTCTTGCTTTGCGGCTCGAAGTAGGCTTGGATTTGGGAGCTTGCTGGTTTAACAATCGGCTCTCCTTGAATGTATTAGCTGGACTTTCCGATTTAATAGCGGTTCACGGTGTGATAACTATCTACGCCTGGTAAATCCGTCTTTGAGTCTGGTCGAGCTTCTAATCAGTTCGTCCTTTTTGGACAAACACTTTTAAGATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCATAA

Created: 2015-07-19 10:10:53 CEST (+0200)
Last modified: 2016-05-17 20:45:43 CEST (+0200)
Viewed: 34 times, last viewed: 2017-02-19 21:21:00 CET (+0100)
Show Log