Observation 210721: Boletus vermiculosoides A.H. Sm. & Thiers
When: 2015-07-18

Notes: Collected at the NJMA foray.
The specimen is preserved for the NJMA herbarium.

DNA Sequencing Discussion:
> A clean and contiguous 1445 bp nrLSU sequence was obtained for this material.
> As expected, the full length sequence did’t return any meaningful hits from a BLAST nucleotide search in GenBank (bolete sequences posted there are much shorter).
> A BLAST search of the 1051 bps sequence fragment (41—>1091) yielded a nearly perfect match (1050/1051 = 99.9% identity; no gaps) with Boletus subvelutipes voucher RV98.102 [GenBank accession #AY612804].
> The second best match that made sense (871/879 = 99.1% identity with 1 gap) was with Boletus vermiculosus strain 222/97 [GenBank accession #DQ534646]. In this case, the overlay region corresponded with the 67—>945 bps fragment of my sequence.

Conclusion:
In my understanding, the mushroom in this observation doesn’t really fit the morphological species concept of B. subvelutipes, so I am willing to bet that RV98.102 is likely to be a misidentification.

Proposed Names

61% (2)
Eyes3
Recognized by sight: Maroon pore surface; upper stipe yellow, with brownish pruinosity and staining brown from bottom to top
Based on chemical features: KOH on cap = mahogany red; this test distinguishes it from B. vermiculosus, which stains vinaceous

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nrLSU sequence posted
By: I. G. Safonov (IGSafonov)
2016-11-24 16:01:31 CST (-0500)

TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTCGAATCTGGCGGTCTTTCGGTCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGACCGTGTATAAGTCTCCTGGAAGGGAGCGTCGCAGAGGGTGAGAATCCCGTCTTTGACACGGACTGCCAGGGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCACGTCGGCAGGGGATCAACCTTGCTTCTCGCTGGGTGTACTTCCCTGTCGACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGGGGAACGTGGCACTCTTCGGGGTGTGTTATAGCCTTTCGTCGCATGCGGTGGTCGGGACTGAGGAACTCAGCACGGCTTCGGTCTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTCGGGTGAATAAACTCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAGTCTTYGACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGTGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCACTTTGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC

Thank you, Gents!
By: I. G. Safonov (IGSafonov)
2016-03-20 14:22:29 CDT (-0400)

I am just a messenger — all the kudos should go to Dr. K who made all of this possible…
Martin, I agree. However, I don’t know how to make this info more visible to folks from the academia. The vouchers, raw data and annotated sequences for all the shooms I post on MO are available for anyone who is interested.

Now that’s what I am talking about
By: Martin Livezey (MLivezey)
2016-03-20 00:25:30 CDT (-0400)

It’s great to see this type of work on MO. We should figure out a way to share this observation with the folks you submitted the samples you compared with on GenBank. They need to document their morphology in this way.

Great Work
By: John Plischke (John Plischke)
2016-03-19 22:54:27 CDT (-0400)

I am glad you are getting good results.

DNA discussion posted
By: I. G. Safonov (IGSafonov)
2016-03-19 21:18:43 CDT (-0400)

Created: 2015-07-19 23:31:02 CDT (-0400)
Last modified: 2016-11-24 21:38:37 CST (-0500)
Viewed: 96 times, last viewed: 2016-11-29 00:33:14 CST (-0500)
Show Log