Observation 210760: Boletus pallidoroseus Both
When: 2015-07-18

Notes: Since this was found in exactly the same spot as obs 103977 and gestalt morphology and the odor match, too, I bet the two obsies are the same species.

Molecular Sequencing Discussion:
> Full-length nrLSU sequence (Haplotype 1 = 1446 bp long):
TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA

AAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTC

GAATCTGGCGGTCTTGCCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGACC

GTGTATAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACG

GACTACCAGTGCTATGTGATACGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCA

AAATGGGTGGTAAATTCCATCTAAAGCTAAATAYAGGCGAGAGACCGATAGCGAACAAG

TACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATT

GCTGAAAGGGAAACGCTTGATGTCAGTCGTGTCGGCCGGGGATCAACCTTGCTTGTTTG

CTGGGTGTACTTCTCGGTCGACAGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGC*G

*AGGGGAACGTGGCACTCTTCGGGGTGTGTTATAGCCTTTCGTCGTATGCGGCGGGTC

GGGACTGAGGAACTCAGCACGGCCYCCGGGTTCTGTGCTTAGGATGCTGGCATAATGG

CCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTG

GGTGACAAACTCGAGCGCGCAATGAAAGTGAAAGTCGAGACCTCTGTCGTGGAGGGCA

TCGACGCCCGGACCTGAGTCTTTGACRACGGATCTGCGGTAGAGCATGCATGTTGGGA

CCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAG

GCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGA

CTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACT

CATGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCT

TAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCTCTTTGTTGGACCGCTCGG

CGATTGGGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAA

CCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTA

GTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAACCCGCTAAGGAGTGTGTA

ACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCC

ACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGT

GAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC

> Haplotype 2 is one bp longer (insert a G next to the one book-ended by *)
> Fragment 52—>1035 (984 bp long) is a 100% overlay with the B. bicolor voucher TH6933 (accession #AY612800). This is the top scoring hit (980/984 = 99.59% identity)
> Fragment 67—>946 (880 bp long) is a 100% overlay with the B. pallidoroseus voucher snHor01 (accession #KF030305). This is the second top scoring hit (876/880 = 99.55% identity). This sequence was used in Phylogenetic overview of the Boletineae by Nuhn et al. (2013)
> Fragment 67—>946 is also a 100% overlay with the L. carminipes voucher MB06-001 (accession #JQ327001). This is the third top scoring hit (876/881 = 99.43% identity; 1 gap). This sequence was used in Phylogenetic overview of the Boletineae by Nuhn et al. (2013)

Conclusion:
I think this collection is B. pallidoroseus based on morphology, chemical tests (for obs 103977) and the characteristic odor. Looking at the massive nrLSU tree published in the 2013 Nuhn et al. paper, B. bicolor, B. pallidoroseus, L. carminipes, and L. pseudosensisiblis all sit in a group called the Carminipes Clade, but there are two distinct and not closely related sets of vouchers in that phylogram where the first three species reside. This makes me think that there was probably misidentification, given the fact that bicolor and pallidoroseus may look very much alike at times.

Proposed Names

85% (1)
Eye3 Eyes3
Recognized by sight: Gross morphology and a strong beef bouillon odor; have previously collected this taxon at the location

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
DNA sequence & discussion posted
By: I. G. Safonov (IGSafonov)
2016-07-14 19:21:24 CDT (-0500)

Created: 2015-07-20 11:21:36 CDT (-0500)
Last modified: 2016-08-03 18:59:30 CDT (-0500)
Viewed: 85 times, last viewed: 2016-11-21 22:00:35 CST (-0600)
Show Log