Observation 212414: Amanita sect. Vaginatae sensu Zhu L. Yang

Proposed Names

47% (2)
Eye3
Recognized by sight
57% (1)
Eye3
Recognized by sight
ret
54% (1)
Based on chemical features: nrITS comparison to sequence in RET’s data base

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Another thought…
By: R. E. Tulloss (ret)
2017-06-22 21:17:54 PDT (-0700)

1% difference in pairwise identity of ITS sequences is a lot in the Vaginatae…well for what my impressions are worth. We need to get deeper into this.

Very best,

Rod

No, Steve, we don’t. Shoot.
By: R. E. Tulloss (ret)
2017-06-22 21:14:10 PDT (-0700)

Our material is kind of old (1984, collected with Jenkins and Bas in Alabama!). We didn’t get an LSU. There is a chance that nrLSU may be a little more stable than nrITS in your material. Linas’ process has improved (again and again); so if we have some DNA in the freezer, he could try deriving nrLSU another time.

Our nrITS for keesii is in GenBank: KX354360

Very best,

Rod

annotation
By: R. E. Tulloss (ret)
2017-06-22 21:08:55 PDT (-0700)

<1..10
nrSSU partial
11..177
ITS1 complete
178..338
5.8S complete
339..503>
nrLSU partial

Rod

A. justicei was only 98%.
By: Stephen Russell (Mycota)
2017-06-22 20:39:43 PDT (-0700)
Do you have any other loci for this species?
By: Stephen Russell (Mycota)
2017-06-22 20:34:35 PDT (-0700)

I can try for a longer ITS and pickup another loci if there is a reference.

A proposed, longer sequence is in this comment. It includes 2 hets…. —>EDITED
By: R. E. Tulloss (ret)
2017-06-22 20:17:19 PDT (-0700)

…these might have been interpreted as identical to the corresponding characters in the keesii sequence.

There is still a distinct difference in one character—character 371 of the sequence below.

Percentage ID is 99.3% now. We don’t know about the variability of the sequence of keesii. We only have one sample of these species.

AGGATCATTATTGAATTGGAAACCCATGGCTAGATAGTGCTTTGCTGGCCCCTTGGGGGCACATGTGCAGGCCGCCTGGTCATTTGTTTCTTTTTGTTCCACCTGTGCACCGTTGTAGACATATTTCCATGTCTACGATATATTTYATACACAATATCATTGAAATATTTYATTTTGTAATAAATTGACAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACACAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAATGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATAAAACTATCAAAACATTCTTGTTTGAGTGCTTTTGGATTGTGGGAGTGCTAGATAGAAAGTTAGCTCTCCTGAAAAACATATATTGGCTTGAAAAGACAATTTGGTGTGATAATCCTTTAWGCACCTTACAAGTCACTCAGCCCCTTTTTATGACTCAT

No way we can get to nrLSU so far as I can see.

In my Geneious files, this sequence is S_RUSSELL_AM137_MO212414 ret. <—FILE NAME CORRECTED

Very best,

Rod

I got em.
By: R. E. Tulloss (ret)
2017-06-22 19:55:53 PDT (-0700)

I was clicking on the wrong tabs.

R

Clicking the files should initiate a download in your browser.
By: Stephen Russell (Mycota)
2017-06-22 19:55:29 PDT (-0700)

I can email them if you cant get it.

Worked out the .ab1 file downloads.
By: R. E. Tulloss (ret)
2017-06-22 19:54:52 PDT (-0700)

R

The upper two images look much more like keesii than the very yellow images.
By: R. E. Tulloss (ret)
2017-06-22 19:52:10 PDT (-0700)

R

Corrected the previous comment.
By: R. E. Tulloss (ret)
2017-06-22 19:50:20 PDT (-0700)

Amanita sp-A07” is an old code now replaced by the provisional name “Amanita keesii”.

http://www.amanitaceae.org?Amanita%20keesii

Rod

The best match without seeing the raw data is to A. keesii — 99.4& (remember…
By: R. E. Tulloss (ret)
2017-06-22 19:44:02 PDT (-0700)

…the sequence is truncated). There are two characters different. One is a het very near the beginning of the sequence; the other is a mismatched character near the end of the sequence. These could both be due to a quality problem considering the sequence is truncated on both ends.

Hoping to hear from you on the issue of the raw data.

Very best,

Rod

Some more… FORGET REQUEST FOR HELP
By: R. E. Tulloss (ret)
2017-06-22 19:34:13 PDT (-0700)

<1..28
ITS1, partial
29..189
5.8S, complete
190..344>
ITS2, partial

Rats, we don’t have the 5’ end of nrLSU.

Steve, I need help on how to get access to the raw data. I clicked on the two tabs labeled with the forward and reverse primers; but that doesn’t seem to reveal .ab1 files… ??

Very best,

Rod

I see you mostly got 5.8S. I have to take a break.
By: R. E. Tulloss (ret)
2017-06-22 17:41:07 PDT (-0700)

More later.

Very best,

Rod

Raw data and ITS
By: Stephen Russell (Mycota)
2017-06-22 15:02:06 PDT (-0700)
Once again, I’ll be very curious about the DNA results.
By: R. E. Tulloss (ret)
2017-06-22 13:48:30 PDT (-0700)

Rod

macro or DNA confirmed?
By: Debbie Viess (amanitarita)
2017-02-01 15:50:23 PST (-0800)

so, your club is doing DNA now? That’s great, if so.

Hello, Steve.
By: R. E. Tulloss (ret)
2015-08-10 18:21:53 PDT (-0700)

Can you tell about the base of the stem? I see fairly long marginal striations. The center of the cap looks yellowish and the margin looks white. My guess is that the spores are inamyloid.

Very best,

Rod

Created: 2015-08-10 17:24:06 PDT (-0700)
Last modified: 2017-06-22 20:19:24 PDT (-0700)
Viewed: 121 times, last viewed: 2017-06-23 21:40:01 PDT (-0700)
Show Log