Observation 213950: Boletaceae Chevall.
When: 2015-08-23

Notes: Cap Surface:
KOH – Green or blue flash to yellow.
Ammonia – Darker red to yellow.

Context – Pale-orange with KOH.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Sounds like a plan…
By: I. G. Safonov (IGSafonov)
2017-04-11 17:40:52 PDT (-0700)

FYI, I’ve posted LSU & TEF-1 sequences for what is believed to be be properly IDed B. carminiporus vouchers obs 244944 and obs 246870.

I am currently going through
By: Stephen Russell (Mycota)
2017-04-11 16:55:27 PDT (-0700)

ITS for all of my collections. Once that is done, I will pickup additional loci where necessary/helpful.

I am currently going through
By: Stephen Russell (Mycota)
2017-04-11 16:55:25 PDT (-0700)

ITS for all of my collections. Once that is done, I will pickup additional loci where necessary.

I am currently going through
By: Stephen Russell (Mycota)
2017-04-11 16:55:24 PDT (-0700)

ITS for all of my collections. Once that is done, I will pickup additional loci where necessary.

Thanks for posting the sequence
By: I. G. Safonov (IGSafonov)
2017-04-11 16:45:49 PDT (-0700)

Unfortunately, ITS in not helpful here because relevant sequences haven’t been posted to GB yet, even if your mushroom happens to be a known taxon. In my experience, nrLSU is more informative in such situations, i.e., both the species and genus uncertain. As an added bonus, LSU sometimes gives a decent resolution at the species level, too.

ITS
By: Stephen Russell (Mycota)
2017-04-11 15:57:06 PDT (-0700)

TAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAACTTCAAGGGGAGGAGAGGGGTTAGACTTGAGACTGTCGCTGGCCCCCCAGGCATGTGCACGTCTCGACCCTTCTTCTCTCATTACACACACACCTGTGCACCATTTGTAGGTCCTCGAAAAAAGGGTCTACGTTTTTCACATCTACACCCCTATCGTATGTCTACAGAATGTATTGAGGATGGCAATAAATCATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCATGCTTTTTGGAGCATGGCTTGGAGTTGGGGGGTTGCTGGCAGCGAAGTGTTGTCGGCTCTCCTGAAATGCATTAGCAAAGGGTGGGCGAGTCTTTGACGTGCACGGCCTTCGACGTGATAATGATCGTCGTGGCTGGAGCGTCGGACAAGCATGAATCCATCCCTGCTTCCAACGTTTCACTAGCTCAAGTCGGGTCGGGGGGTTGCTTTTAGTTAGCTACTAGTCGGTCGCAAGGCCGACGAACGCTCGCAGGCAGCTCTGCTTGGCTTTTGTCTTTTGTCACCTTCGAAACTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTT

Created: 2015-08-24 18:32:31 PDT (-0700)
Last modified: 2015-08-24 21:31:03 PDT (-0700)
Viewed: 70 times, last viewed: 2017-06-27 10:56:27 PDT (-0700)
Show Log