Observation 215259: Entoloma subgenus Leptonia (Fr. : Fr.) Noordel.
When: 2015-07-09
(42.6351° -82.5001° )

Notes: Entoloma blue stem, brown top
sequencing is in the works, will update observation later

2017-02-17 extra notes:
Microscopy – see spores photo, sizes are min-avg-max after measuring 15
L: 8.4-10.5-12.8um
W: 6.7-7.8-9.7um
Dried specimen measurements:
cap width: 11-8mm (flattened somewhat)
stipe: 0.4 × 18-13 mm

https://www.ncbi.nlm.nih.gov/nuccore/KY706188
>KY706188.1 Entoloma griseocyaneum isolate PO6 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
AACCTGCGGAAGGATCATTATTGAATAACTTGGTTTAGATAGTTGCTGGCCCTTCGTGGGCATGTGCACGTCTATTCCATCTTTACAACCACCTGTGCACTTTGTGTAGATTTTGAATAACTCTCGAGGCATAACTCGGTTTGAAAGACTGCTGTGCGAAGGCTCAGCTTTTTTTCTGTGTTCAAATCTATGTTCCATTATACTCCAAAATAAAGTATTTGAAGCTTTTTACATTTGTAAACATATCTTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACCTTTCGGGCTTTCATTTAGAAAGCTTGTCAGGCTTGGATTCTGGGAGTATGCTGACTTATAATGAATCAGCTCTTCTCAAATATATTAGCCAAGATCATCGCTGCATCATCTTTGATATGATAATTATCTATATCTTGAATGTTGCCTAGCGTTTCCTCCAAGGAAAGATCAGGCTTAAAATCGTCTCAGGACAAACAAATTTTTGAATCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGTAGTCTTTGGCTGCCCGAGTTGTAATCTAGAGAAGCGTTATCCGCGCTGGACCGTGTATAAGTCTCCTGGAATGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCGGGGCATTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTAAAGTCAGTCGCATTAGCTAGGGATCAGCCTTGCTTTTGCTTGGTGTATTTCCTGGTTGATGGGTCAGCATCAATTTTGACCAGTGGAAAAAGTTCAAGGGAATGTGGCATCTTCGGATGTGTTATAGCCTTTGGTCGTATACGCTGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGGTTTTAAACCACGTTCGTGCTTAGGATGCTAGGCATAATGGCTTTAATCGA

Proposed Names

28% (1)
Recognized by sight
2% (3)
Recognized by sight: brown cap, slender blue stem
Used references: Arora 1986 (MD 2nd Ed.) – pg 242 key to Entoloma
56% (1)
Eye3
Used references: Breitenbach, J. and F. Kraenzlin. 1995. Fungi of Switzerland Volume 4 Agarics 2nd part. Mykologia Lucerne, Switzerland. (Entoloma griseocyaneum is #36)
Based on microscopic features: Spores should be: 8.3-11.9 × 6.7-8.4um

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
really interesting Leptonia!
By: Debbie Viess (amanitarita)
2017-03-31 15:21:42 CDT (-0400)

I look forward to seeing what your sequencing shows.

griseocyaneum
By: Chris Hay (hayfield)
2017-02-17 16:55:33 CST (-0500)

I underestimated this one – there are several species with brown caps and blue stalks. In the book from Switzerland, this is the only one that is recorded in North Amerca (and not just Europe).
Other descriptions look quite different from that in the book or here.
http://www.first-nature.com/fungi/entoloma-griseocyaneum.php

In the second photo it appears the larger fruiting body is not convex but flat to concave (more open), which doesn’t fit this species. More microscopy would help to confirm either way.

Created: 2015-09-04 16:47:05 CDT (-0400)
Last modified: 2017-06-29 15:00:08 CDT (-0400)
Viewed: 106 times, last viewed: 2017-06-29 22:14:13 CDT (-0400)
Show Log