Observation 215388: Lactarius fuliginosus (Fr.) Fr.

Proposed Names

57% (1)
Recognized by sight
85% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Okay – thanks, Stephen
By: I. G. Safonov (IGSafonov)
2017-04-11 15:00:05 MDT (-0600)
ITS
By: Stephen Russell (Mycota)
2017-04-11 14:53:28 MDT (-0600)

AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAACAAAGACGTGGGAGGCGCTCCAAGGCTGTCGCCGACTCGAAAGGGTCGTTGCACGCCGGGAGGGCGTCCTCTTGCGTGAAATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGCTTCCTCCTCGAGGCGGCTCGCGTTTTTCACACAAACCCCCTTTGTAAAYGTCTGTAGAATGTCTTCATTTTGTTTGCGTYGACACGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTTTTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGCTTTGCTGGACTGGAAAGGCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGACGAGACAATGTTCGAGCTTGCCTCGACCACGTACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA

So it matches other L. fuliginosus sequences in GB?
By: I. G. Safonov (IGSafonov)
2017-04-11 14:38:55 MDT (-0600)
I still call it L. fumosus
By: Stephen Russell (Mycota)
2017-04-11 14:33:43 MDT (-0600)
Ya, I have a sequence for it.
By: Stephen Russell (Mycota)
2017-04-11 14:29:46 MDT (-0600)
Determination by DNA?
By: I. G. Safonov (IGSafonov)
2017-04-11 14:22:50 MDT (-0600)

Created: 2015-09-05 11:09:49 MDT (-0600)
Last modified: 2017-04-11 13:44:30 MDT (-0600)
Viewed: 60 times, last viewed: 2017-06-20 18:20:57 MDT (-0600)
Show Log