Observation 215388: Lactarius fuliginosus (Fr.) Fr.

Proposed Names

57% (1)
Recognized by sight
85% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Okay – thanks, Stephen
By: I. G. Safonov (IGSafonov)
2017-04-11 16:00:05 CDT (-0500)
ITS
By: Stephen Russell (Mycota)
2017-04-11 15:53:28 CDT (-0500)

AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAACAAAGACGTGGGAGGCGCTCCAAGGCTGTCGCCGACTCGAAAGGGTCGTTGCACGCCGGGAGGGCGTCCTCTTGCGTGAAATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGCTTCCTCCTCGAGGCGGCTCGCGTTTTTCACACAAACCCCCTTTGTAAAYGTCTGTAGAATGTCTTCATTTTGTTTGCGTYGACACGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTTTTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGCTTTGCTGGACTGGAAAGGCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGACGAGACAATGTTCGAGCTTGCCTCGACCACGTACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA

So it matches other L. fuliginosus sequences in GB?
By: I. G. Safonov (IGSafonov)
2017-04-11 15:38:55 CDT (-0500)
I still call it L. fumosus
By: Stephen Russell (Mycota)
2017-04-11 15:33:43 CDT (-0500)
Ya, I have a sequence for it.
By: Stephen Russell (Mycota)
2017-04-11 15:29:46 CDT (-0500)
Determination by DNA?
By: I. G. Safonov (IGSafonov)
2017-04-11 15:22:50 CDT (-0500)

Created: 2015-09-05 12:09:49 CDT (-0500)
Last modified: 2017-04-11 14:44:30 CDT (-0500)
Viewed: 51 times, last viewed: 2017-04-23 06:16:18 CDT (-0500)
Show Log