Observation 215388: Lactarius fuliginosus (Fr.) Fr.

Proposed Names

57% (1)
Recognized by sight
85% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Okay – thanks, Stephen
By: I. G. Safonov (IGSafonov)
2017-04-11 14:00:05 PDT (-0700)
ITS
By: Stephen Russell (Mycota)
2017-04-11 13:53:28 PDT (-0700)

AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAACAAAGACGTGGGAGGCGCTCCAAGGCTGTCGCCGACTCGAAAGGGTCGTTGCACGCCGGGAGGGCGTCCTCTTGCGTGAAATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGCTTCCTCCTCGAGGCGGCTCGCGTTTTTCACACAAACCCCCTTTGTAAAYGTCTGTAGAATGTCTTCATTTTGTTTGCGTYGACACGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTTTTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGCTTTGCTGGACTGGAAAGGCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGACGAGACAATGTTCGAGCTTGCCTCGACCACGTACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA

So it matches other L. fuliginosus sequences in GB?
By: I. G. Safonov (IGSafonov)
2017-04-11 13:38:55 PDT (-0700)
I still call it L. fumosus
By: Stephen Russell (Mycota)
2017-04-11 13:33:43 PDT (-0700)
Ya, I have a sequence for it.
By: Stephen Russell (Mycota)
2017-04-11 13:29:46 PDT (-0700)
Determination by DNA?
By: I. G. Safonov (IGSafonov)
2017-04-11 13:22:50 PDT (-0700)

Created: 2015-09-05 10:09:49 PDT (-0700)
Last modified: 2017-04-11 12:44:30 PDT (-0700)
Viewed: 61 times, last viewed: 2017-09-04 11:37:23 PDT (-0700)
Show Log