Observation 215388: Lactarius fuliginosus (Fr.) Fr.

Proposed Names

57% (1)
Recognized by sight
85% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Okay – thanks, Stephen
By: I. G. Safonov (IGSafonov)
2017-04-11 17:00:05 CDT (-0400)
ITS
By: Stephen Russell (Mycota)
2017-04-11 16:53:28 CDT (-0400)

AAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGTAACAAAGACGTGGGAGGCGCTCCAAGGCTGTCGCCGACTCGAAAGGGTCGTTGCACGCCGGGAGGGCGTCCTCTTGCGTGAAATCCATCTCACCCCTTTTGTGCACCATCGCGTGGGCTTCCTCCTCGAGGCGGCTCGCGTTTTTCACACAAACCCCCTTTGTAAAYGTCTGTAGAATGTCTTCATTTTGTTTGCGTYGACACGCGATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAATCTCAACCTCCTTGGTTTCTTTTGAACGCCAAAGGAGGCTTGGACTTTGGAGGGCTTTGCTGGACTGGAAAGGCCAGCTCCTCTCAAATGAATTAGCGAGGTTCCCTTTGCCGATCCTCGACGTGTGATAAGATGCTTCCACGTCTCGGTCTTTGGCTCTGTCGCCTTTTGGGACCTGCTTCCAATCGTCTCTCGACGAGACAATGTTCGAGCTTGCCTCGACCACGTACCCTTGACCTCAAATCGGGTGAGACTACCCGCTGAACTTA

So it matches other L. fuliginosus sequences in GB?
By: I. G. Safonov (IGSafonov)
2017-04-11 16:38:55 CDT (-0400)
I still call it L. fumosus
By: Stephen Russell (Mycota)
2017-04-11 16:33:43 CDT (-0400)
Ya, I have a sequence for it.
By: Stephen Russell (Mycota)
2017-04-11 16:29:46 CDT (-0400)
Determination by DNA?
By: I. G. Safonov (IGSafonov)
2017-04-11 16:22:50 CDT (-0400)

Created: 2015-09-05 13:09:49 CDT (-0400)
Last modified: 2017-04-11 15:44:30 CDT (-0400)
Viewed: 60 times, last viewed: 2017-06-20 20:20:57 CDT (-0400)
Show Log