Observation 215734: Cotylidia undulata (Fr.) P. Karst.
When: 2014-10-30
42.6844° -80.4636°
0 Sequences

Notes:

Minute but common in more open mossy places of this restored tall grass prairie. Not tough or fragile but very flexible/ bendable.
must check microscope for undulations to confirm ID
sequencing is in the works, will update observation later

https://www.ncbi.nlm.nih.gov/nuccore/KY706160

>KY706160.1 Cotylidia undulata isolate DM10 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
AACCTGCGGAAGGATCATTATCGAGTTTTGATGTGGGTTTGATGCTGGCCTTTCGAGGCATGTGCTCGCCCCGCTCAATCCACTCTACACCTGTGAACCATTGAGGTGCTGCCCTCCAATTTGGAGCAGCTTCCCTTTTGACCTCCCTCTGGGAGGACGAGAGGTGAGGCCGGGGTGACACCTCTACTTACAAACACTTAAAGTATAACAGAATGTAACCGCCAGCAATGGCAAAACAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATTCTCAACTTCACAAGCTTTTTGTGAGCATGTGAAGCTTGGACTTGGGGGTTGCTGGCCTTTATTGGTCGGCTCCTCTTGAATGCATTAGCTGGACTTTCTGATCACAGAGCGGTTCACGGTGTGATAATTATCTACGCCATGGTAAGCCCGTCTCTGAGTTCTGGTCGAGCTCATAATCGTCCTCGGACACTTTTCAAATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTTTTGCCGTCCGAGTTGTAATCTGGAGAAGCGTTTTCCGCGTTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATACGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGTCCGGGACTCAGCCTTGCTTCTGCTTGGTGTACTTCCTGGTTGACGGGCCAACATCGATTTTGATCGGCGGATAAAGGTAGAGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTCTATCGGATGCGTCGGTTGGGATCGAGGACCGCAGCACGCCTTTTTGGCCGGGGTTCGCCCACGTAACGTGCTTAGGATGTTGGCATAATGGCTTTAAGCGA

Proposed Names

60% (2)
Eye3 Eyes3
Recognized by sight: Relatively small size (vs. other spp.), thin and soft, distinct stem, on dry soil among mosses
Used references: Not C. pannosa or C. muscogena from Czech key (Kout and Z’ibarov’a 2013):
Kout J. and L. Zíbarová. 2013. Revision of the genus Cotylidia (Basidiomycota,
Hymenochaetales) in the Czech Republic. Czech Mycol. 65(1): 1–13. http://www.czechmycology.org/_cmo/CM65101.pdf
Based on microscopic features: see pseudocystidia image

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Nice find!
By: Django Grootmyers (heelsplitter)
2016-11-13 19:36:06 MST (-0700)

It looks like the pictures I’ve seen of C. undulata. I have some resources for IDing North American stipitate stereoids if you’d be interested in those.

Created: 2015-09-08 08:26:03 MDT (-0600)
Last modified: 2017-06-29 10:24:55 MDT (-0600)
Viewed: 80 times, last viewed: 2017-12-10 12:52:44 MST (-0700)
Show Log