Observation 215764: Boletaceae Chevall.
When: 2015-09-05

Notes: > There were two discrete collections of this bolete species harvested on two separate days from two different locations; this one is #1 from Saturday, possibly from the mixed conifer-hardwood forest of Jug End State Reservation
> The colors in pix are accurate
> Lemon yellow flesh gradually staining blue, mostly in the bottom third of the stipe and just above the tubes
> No distinct odor
> KOH = rusty brown / orange on cap cuticle and medium orange on exposed context

DNA Sequencing Discussion:
> A clean and contiguous 1443 bps nrLSU sequence was obtained for this material.
> A GenBank BLAST search of the full-length sequence returned no meaningful hits.
> Surprisingly, a GenBank search of a sequence fragment was equally unsuccessful!
> The identity of this bolete continues to be a mystery…

TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGATGAGCTCAAATTTTGAATCTGGCGGTCTTCGGCCGTCCGAGTTGTAATCTAGAGAAGCGTTTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCCGGGGATCAACCTTGCTTCTCGCTGGGTGCATTTCCTGGTCGACGGGTCAGCATCAGTTTCGGTCGCCGTACAATGGCAAAGGGAACGTGGCACTCTTCGGAGTGTGTTATAGCCTTTCGTCGTATGCGGTGGTTGGGACTGAGGAACTCGGCACGATTTCGGTCTGTGTCTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGCAAACCCGAGCGCGTAATGAAAGTGAAAGTCGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTGAGTCTTTGACGACGGATCTGCGGTAGAGCATGCATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCCGTCGCTTTGTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCTCTAGTGC

Proposed Names

57% (1)
Eye3 Eyes3
Recognized by sight
45% (2)
Recognized by sight: I haven’t collected this species, but online photos look like a good fit.
15% (2)
Based on chemical features: Phylogenetic tree indicates that this could be in Aureoboletus
0% (2)
Based on chemical features: Phylogenetic tree indicates that this could be in Imleria

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Aureoboletus?
By: I. G. Safonov (IGSafonov)
2016-10-23 18:43:07 MDT (-0600)

No, this bolete doesn’t look at all like the classic, “core” Aureoboletus species that include such iconic taxa as A. auriporus, A. gentilis, A. innixus and A. roxannae. The fact that none of these species are part of your phylogram also make the connection rather unrealistic.
Nuhn et al. published a humongous LSU tree as part of supplementary data to their paper. I will ask Roy Halling if he can help.

To make a tree that makes more sense
By: Alan Rockefeller (Alan Rockefeller)
2016-10-23 15:39:21 MDT (-0600)

You would need to include sequences which you trust to be named correctly, and these would give you points of reference. This tree includes just the close BLAST matches, so it’s not at all representative of the Boletales as a whole, and surely many of the sequences are misnamed. If you can get some of the people who are studying the boletales to plug this sequence into their tree, you’d likely be able to find the answer many of your questions.

It does look kind of like Aureoboletus, doesn’t it?

I wonder if the Aureoboletus sequences in this tree are properly named. To find out one could make an Aureoboletus LSU tree and see if these cluster with the rest of them.

Bizarre!
By: I. G. Safonov (IGSafonov)
2016-10-23 12:55:53 MDT (-0600)

Thanks for doing the work, Alan. Well, what can I say?…

First, I am having trouble understanding your phylogram in term of what I know about the phylogenetic framework of the Boletaceae from the works of Nuhn et al. (2013) and Wu et al. (2014). For instance, your tree places some of the basal clades in the Boletacea (Zangia and Chaciporus) on one end of the “spectrum” in close proximity to Aureoboletus, a more evolved lineage on the on the other end, with nothing in between.

Second I am having difficulty picturing my bolete sitting “between I. badia and Aureoboletus” based both on the morphology and knowing where the two aforementioned genera sit in the Boletacea phylogenetic tree. I think that morphologically, this yellow & red, yellow-pored and bluing bolete should belong in the poorly-resolved “Pulveroboletus Group” of Wu et al. that houses the bicolor and carminipes groups. Aureoboletus is in the subfamily Xerocomoideae, whereas Imleria is nested deep in the Boletoideae. The two genera are separated by a big evolutionary chasm.

So how do we make sense of it all? We don’t — IMO there is simply not enough info to make any definitive conclusions at this time. The LSU sequence (presuming its quality/integrity are beyond reproach) appears to be the “trouble-maker”. It’s much longer that most sequences in GB and sequence alignment could be the problem. But, regardless of this, GenBank identity match is always below 98.5 % for the full-length and trimmed sequences, the best hit in terms of the overall score is invariably Aureoboletus projectellus, and the overall suggested phylogenetic placement is Xerocomoideae. I have a big problem with these results at this time.

Phylogenetic tree
By: Alan Rockefeller (Alan Rockefeller)
2016-10-22 20:55:39 MDT (-0600)

I made a phylogenetic tree with some of the GenBank matches. It looks like it is between Imleria (Xerocomus) badius and Aureoboletus, perhaps a little closer to the Aureoboletus side.

LSU sequence posted
By: I. G. Safonov (IGSafonov)
2016-10-21 22:18:20 MDT (-0600)
Dave,
By: I. G. Safonov (IGSafonov)
2016-01-28 08:43:00 MST (-0700)

To my knowledge miniato-pallescens is not in GenBank. Also, I checked the Overview of the Boletenae paper by Nuhn et al. that lists the names and GenBank accession numbers of all the boletes they included in their study, and it wasn’t there either.

Is molecular data for miniato-pallescens available?
By: Dave W (Dave W)
2016-01-28 05:53:54 MST (-0700)
DNA discussion posted
By: I. G. Safonov (IGSafonov)
2016-01-27 23:14:49 MST (-0700)

Nothing close was found in GenBank.

Yes, Dave, I remember…
By: I. G. Safonov (IGSafonov)
2015-09-09 20:26:24 MDT (-0600)

obs 142424 from the Pine Barrens very well. In retrospect, I should have saved it, but then I was not yet “infected” with the DNA bug at the time. The two appear to be close to each other, yet I think they are not the same species. I’ll ask LK to sequence this collection — at least get an ITS “barcode” to see if it matches anything in GenBank.

This somewhat reminds me of…
By: Dave W (Dave W)
2015-09-09 20:16:34 MDT (-0600)

miniato-olivaceus. That’s what motivated me to quick-check some miniato-pallescens photos online.

Found this obs 142424.

Dave,
By: I. G. Safonov (IGSafonov)
2015-09-09 13:42:10 MDT (-0600)

B. miniato-pallescens is a possibility, though I have never seen even a single bona fide example being positively identified in the field. Beside the description of it in B-R-B, I don’t have a well-described or understood morphological concept for this species.

Dave,
By: I. G. Safonov (IGSafonov)
2015-09-09 08:25:13 MDT (-0600)

These are definitely not subglabripes – take a closer look at the color and texture of the stipe.
From my perspective, they are from the family of bluing “red & yellow” boletes with yellow pores.
We did consider B. miniato-olivaceus, but, as you noted, the context was too yellow and there was too much bluing.
The dissection pic was taken immediately following the slicing and doesn’t show the full extent of oxidation. The bluing action slowly intensified over several minutes following dissection. The blue areas expanded to claim more territory but never merged to cover the entire surface. The bottom third or so of the stipe eventually turned deep blue, while bluing in the cap remained very light. Interestingly, the outer surface never blued after handling.
The stature of these was characterized by long, straight and slender stipes covered by reddish-orange dots forming a dense pattern of streaks and lines over the lemon-yellow background color. The cap color was reddish orange-brown.

Very interesting!
By: Dave W (Dave W)
2015-09-09 05:54:10 MDT (-0600)

Context too yellow for miniato-olivaceus, and stipe ornamentation wrong for pseudosensibilis. How about subglabripes? I have seen examples of this species where the context blues slightly.

Created: 2015-09-08 22:38:58 MDT (-0600)
Last modified: 2016-10-23 20:38:48 MDT (-0600)
Viewed: 256 times, last viewed: 2016-10-25 11:50:07 MDT (-0600)
Show Log