Observation 217160: Caloboletus Vizzini
When: 2015-09-25
(43.3616° -77.9547° )

Notes: A single fruiting body growing in grass in a small stand of beech trees close to edge of woods and next to the trich in obs 217153.
> The cap is glabrous, grayish-tan, reminiscent of B. pallidus
> The cap margin has a narrow band of sterile tissue
> The pore surface is pale yellow, bluing when injured
> The stipe is of raspberry rose (#B3446C) to raspberry (#872657) color, has a mostly smooth or slightly ribbed texture here and there, with a fine reticulation and vertical ridging at the apex and just below (see the pix)
> The taste is bitter, but not as harsh as the bitter bolete, and slightly astringent
> The exposed context shows a remarkable staining action consisting of blue, yellow and reddish-brown (see the pic)
> Chemical tests were not performed

Molecular Data Discussion:
> A clean and contiguous 1443 bps nrLSU sequence has been obtained for this material. The identity of the 124th nucleotide is ambiguous and is represented by “N” (it might still be possible to resolve it though).
> A GenBank BLAST search of sequence fragment 1—>961 returned the following relevant results (sorted by identity):
- Caloboletus radicans voucher HKAS80856, accession #KJ184557 (878/888 = 98.9% similarity, no gaps).
- Caloboletus rubripes voucher 8722, accession #KF030280 (867/877 = 98.9% similarity; no gaps). This bolete is a North American species found in the West.
- Boletus rubripes voucher OMS 1000895, accession #KT968656 (895/906 = 99.1% similarity; no gaps). This bolete is a North American species found in the West.
- Caloboletus panniformis voucher HKAS57410, accession #KJ184555 (915/928 = 98.6% similarity; no gaps)
- Caloboletus calopus voucher 112606, accession # KF030279 (853/866 = 98.5% similarity; no gaps). Known from Europe and North America.
- Boletus inedulis voucher sn2002, accession # KF030281 (858/877 = 97.8% similarity; no gaps). Known only from North America.

Conclusion:
Molecular sequencing of the nrLSU locus supports the original identification made from gross morphology as Caloboletus. Genetically, the closest relative at this time is Caloboletus rubripes. However, this bolete looks sufficiently different from any other member of Caloboletus found in northeastern North America (C. firmus, C. inedulis and C. roseipes), and the molecular data is in agreement with this notion. Also, there are no perfect matches recovered from a GenBank search of nrLSU sequences. Taken together the evidence suggests this is possibly an undescribed/new taxon from North America.

Proposed Names

85% (1)
Eye3 Eyes3
Recognized by sight
Based on chemical features: A nrLSU sequence of this material aligned well with a bunch of Caloboletus spp. The closest NA relative is C. rubripes. There were no perfect matches in GenBank, suggesting this is a new North American taxon.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
nrLSU sequence MO217160
By: I. G. Safonov (IGSafonov)
2016-02-05 23:55:18 CST (-0500)

> nrLSU sequence of MO217160/Caloboletus sp.:
TTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGAGGGAAGAGCTCAAATTTTGAATCNGGCGGCGTTCAGCCGTCCGAGTTGTAATCTAGAGAAGCGTCTTCCGCGCTGGACCGTGTACAAGTCTCCTGGAAGGGAGCGTCGTAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTATGTGATGCGCTCTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAACGGGTGGTAAATTCCATCTAAAGCTAAATACATGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTCGGCTGGGGATCAACCTTGCTTCTCGCTGGGTGTACTTCTCAGTCGACGGGTCAGCATCAGTTTCGGTCGCCGTACAAGGGCGAGGGGAATGTGGCACTCTTCGGAGTGTGTTATAGCCTTTCGTCGTATGCGGCGCTCGGGACTGAGGAACTCAGCACGGCCTCGGTTTGTGCTTAGGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTGGCAAACCCGAGCGCGTAACGAAAGTGAAAGTTGAGACCTCTGTCATGGAGGGCACCGACGCCCGGACCTGAGTCTTTGACGAAGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCGTGTATCAGATTTATGTGGTAAAGCGAATGATTAGAGGCCTTGGGGTTGAAACAACCTTAACCTATTCTCAAACTTTAAATATGTAAGAACGAGCTGTCGCTTCGTTGGACAGCTCGGCGATTGAGAGTTTCTAGTGGGCCATTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTCATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCGTCAGCGTTGAAGTGACGCGCTGACGAGTAGGCAGGCGTGGAGGTCGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACAGCCTCTAGTGC

Created: 2015-09-28 15:58:29 CDT (-0400)
Last modified: 2017-01-01 17:12:14 CST (-0500)
Viewed: 98 times, last viewed: 2017-05-11 18:42:28 CDT (-0400)
Show Log