Observation 217658: Leccinum sect. Leccinum
When: 2015-09-26
(42.9596° -77.682° )

Notes: Notes: A single specimen growing in a stand of young big-tooth aspen (Populus grandidentata), intermixed with a bit of black oak, and in the immediate vicinity of obs 217610.

> PILEUS: medium orange with a flap of sterile tissue [this feature places the specimens in Leccinum sect. Leccinum sensu Smith & Thiers]; the cap shape is conical, as opposed to the convex, cushion-like silhouette of obs 217610; the cap slope and pore surface meet at a sharp angle, accentuating the cap edge
> CAP SURFACE: smooth, with very few concolorous fibrils visible
> PORE SURFACE: pale grayish-tan, staining brown upon injury
> STIPE: white background color, with large, black, widely-spaced scabers projecting from the surface; this pattern appears different from the dense pattern of smaller and flatter scabers of obs 217610
> EXPOSED CONTEXT: staining reddish-brown, then brown, then violet, then blackish (see the pix)
> FeSO4 on context = blue
nrLSU sequence of MO217658:
TCCCCTAGTAACTGCGAGTGAAGAGGGAAAAGCTCAAATTTTGAATCTGGCGGTCATCTAGGCCGTCCGAATTGTAATCTAGAGAAGTGTCTTCCGCGCTGGCCCGTGTACAAGTCTCCTGGAAGGGAGCATCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGGGCTATGTGATGCACTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAAACCGATAGTGAACAAGTACCGTGAGGGAAAGATCAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGATGTCAGTCGCGTTGATTAGGGATCAACCTTTAATTAGGTGTACTTCCTAGTCGACGGGTCAGCATCAGTTTCGGTCATCGTACAAAGGCAAGGGAAAGTAACTTATAATTATGGACCCTCGTCGGATGCGGTGGTCGGGACTGAGGAAACCTCTGCACCTTTTCGTTAGTGTGTTCAGAGATGCTGGCATAATGGCCTTAAGCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACATGCCTGCGAGTGTTTGGGTTTGCAAACTCGAGCGCGTAATGAAAGTGAAAGTTGAGACCTCTGTCGTGGAGGGCATCGACGCCCGGACCTCTTGTCTTTGACGAGGGATCTGCGGTAGAGCATGTATGTTGGGACCCGAAAGATGGTGAACTATGCCTGAATAGGGTGAAGCCAGAGGAAACTCTGGTGGAGGCTCGTAGCGATTCTGACGTGCAAATCGATCGTCGAATTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCTGCCGAAGTTTCCCTCAGGATAGCAGAAACTCATTGTTGATCAGATTTATGTGGTAAAGCGAATGATTAGAGGACTTGGGGTCGAAACGACCTTGACCTATTCTCAAACTTTAAATATGTAAGAACGAGCAGTCGCTCAATTTGGACCGCTCGGCGATTGAGAGTTTCTAGTGGGCCAGTTTTGGTAAGCAGAACTGGCGATGCGGGATGAACCGAACGGGAGGTTAAGGTGCCGGAATACACGCTTATCAGACACCACAAAAGGTGTTAGTTCATCTAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATGAACTAGCCCTGAAAATGGATGGCGCTCAAGCGTGTTACCCACACCTCCCCCTTAGCGTTGAAGTGACGCGCTAAGGAGTAGGCAGGCGTGGGGGTAGTGAAGAAGCCTTGGCAGCGATGCTGGGTGGAACCGCCCCTAGTGC

Molecular Data Discussion:
> A clean 1364 bp nrLSU sequence was obtained for this material.
> This was compared with the 1440 bp nrLSU sequence of obs 217610, and the overlapping portions were found to be 100% identical.

Conclusion: Despite the apparent subtle morphological differences between this leccinum species and that of obs 217610, a simple head-to-head comparison of the derived nrLSU sequences suggests both scaber stalks are the same species.

Images

560937
560938
560939
560940
560941
Photographed <1 min after dissection
560942
Photographed 2 min after dissection
560943
Photograhed 4 min after dissection
560944
Photographed 22 min after dissection; the blue stains on right half of cap are due to FeSO4
560945
Photographed 45 min after dissection; the blue stains on right half of cap are due to FeSO4

Proposed Names

28% (1)
Recognized by sight: Orange cap with marginal flaps; exposed context stains reddish-cinnamon at first
Used references: The Boletes of Michigan by Smith & Thiers
57% (1)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
DNA discussion posted
By: I. G. Safonov (IGSafonov)
2016-03-19 17:10:53 PDT (-0700)

Created: 2015-10-03 18:53:44 PDT (-0700)
Last modified: 2017-04-19 10:00:57 PDT (-0700)
Viewed: 56 times, last viewed: 2017-04-23 18:23:26 PDT (-0700)
Show Log