Observation 222250: Ganoderma curtisii (Berk.) Murrill
When: 2015-11-07
(17.3124° -96.4441° 2155m)
No herbarium specimen

Notes: On an unknown tree root.

Spore measurements are off by a lot!

Spores ornamented and truncate, 11.3 – 15.5 × 8.0 × 10.4.

15.1 × 10.1
14.6 × 8.0
14.1 × 9.5
15.5 × 10.2
11.9 × 8.1
11.3 × 8.0
14.2 × 8.8
14.4 × 8.5
13.0 × 8.0
13.6 × 9.5
15.0 × 10.4

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
I got a match
By: MSchink
2015-12-23 02:14:13 EST (-0500)

With G.curtisii when I compared to known sequences from a colleagues collections.

The morphology fits too, probably near the southern edge for the range of this species as I do not know if it has been reported from Central and South America or not.

I see three perfect matches
By: Alan Rockefeller (Alan Rockefeller)
2015-12-23 00:39:55 EST (-0500)

How did you do your search?

When I paste the sequence from the comment below into NCBI BLAST, I get the following three 100% matches:

http://www.ncbi.nlm.nih.gov/nucleotide/592748424
http://www.ncbi.nlm.nih.gov/nucleotide/405131981
http://www.ncbi.nlm.nih.gov/nucleotide/557046683

No match
By: Oluna & Adolf Ceska (aceska@telus.net)
2015-12-22 23:53:32 EST (-0500)

with any of the 17 sequences available on GenBank. Why not?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 23:16:57 EST (-0500)

GTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATCCACTCTACACCTGTGCACTTACTGTGGGCTTCAGATCGCGAGGCAGGCTCTTTACCGGGCTTGCGGAGCGCATCTGTGCCTGCGTTTATCACAAACTCTATAAAGTAACAGAATGTGTATTGCGATGTAACGCATCTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAATCTTCAACCTACAAGCTTTTGTGGTTTGTAGGCTTGGACTTGGAGGCTTGTCGGCCGTTATTGGTCGGCTCCTCTTAAATGCATTAGCTTGGTTCCTTGCGGATCGGCTTTCGGTGTGATAATATCTACGCCGCGACCGTGAAGCGTTTGACGAGCTTCTAACCGTCTTATAGACAGCTTTATGACCTCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Created: 2015-11-09 02:10:33 EST (-0500)
Last modified: 2016-01-14 07:09:35 EST (-0500)
Viewed: 68 times, last viewed: 2016-10-26 15:24:41 EDT (-0400)
Show Log