Observation 222532: Boletus pinophilus Pilát & Dermek
When: 2015-11-08
(17.3127° -96.4413° 2149m)
No herbarium specimen

Notes: Under 5 needle pine.

Pileus viscid.

Odor strong and unique, and not entirely pleasant.

Spores 13.5 – 15.1 × 4.5 – 5.3.

13.0 × 4.7
13.5 × 4.6
13.5 × 5.0
13.6 × 4.8
13.6 × 4.8
13.7 × 4.6
13.7 × 4.7
13.7 × 4.7
13.9 × 5.1
14.0 × 4.6
14.0 × 4.8
14.0 × 5.3
14.1 × 4.5
14.3 × 4.5
14.3 × 4.6
14.3 × 4.8
14.3 × 4.9
14.3 × 5.0
14.5 × 4.5
14.5 × 4.8
14.5 × 5.0
14.5 × 5.3
14.5 × 5.4
14.6 × 5.1
14.7 × 4.7
14.7 × 4.8
14.9 × 5.0
15.1 × 4.3
15.1 × 5.0
15.2 × 4.7

Images

574398
DSC_1156_modified.JPG
574395
DSC_1161_modified.JPG
574396
DSC_1173_modified.JPG
574397
DSC_1180_modified.JPG
574399
DSC_1133_modified.JPG
574400
DSC_1131_modified.JPG
574401
DSC_1132_modified.JPG
574402
DSC_1130_modified.JPG
574403
DSC_1122_modified.JPG
574404
DSC_1120_modified.JPG
574405
DSC_1110_modified.JPG
590581
spore1000-2.jpg
Spores 1000x
590582
bolete200x.jpg
Basidia 200x DIC. 50 micrometers? 20 micrometers? The truth is probably somewhere in between.
590584
bolete1000x-3.jpg
Spores 1000x
590585
bolete1000x.jpg
Spores 1000x
590588
sp11.jpg
Spores 1000x
590766
orig.jpg
Basidia 400x

Proposed Names

29% (1)
Recognized by sight
58% (1)
Eye3 Eyes3
Based on chemical features: In the ITS sequence there is one solid base pair difference and two ambiguous differences from the European Boletus pinophilus.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Difference of this species and European pinophilus
By: Gerhard Koller (Gerhard)
2015-12-22 20:51:06 GMT (+0000)

First of all, the cap surface bears no resemblance at all … it is a mixture between aestivalis/reticulatus and in its wrinkles maybe even mottiae … the color is like aestivalis too whereas pinophilus has a reddish to almost violet hue in the cap and young appears like somewhat pruinose and whitish-reddish or liver-colored. Also the pore surface is too yellow in my book, the stem is too slender because pinophilus has a clubby one. What about the smell? The smell of pinophilus is different to all other king boletes it has a slight Scleroderma odor to it but not that penetrant and foul though. Upon cooking pinophilus turns green in the cap cuticle.

Interesting…
By: Davide Puddu (Davide Puddu)
2015-12-22 18:08:09 GMT (+0000)

But i don’t see it so near to B.pinophilus, it seems like a midway to B.pinophilus and B.aestivalis , the cap has a different texture, the slender stem and i don’t see the red under the cuticle as i would expect to see in section in this species,although the color of the stipe looks almost identical.

Boletus subcaerulescens has been sequenced
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 13:28:52 GMT (+0000)

My sequence is 6 base pairs different from B. subcaerulescens – three questionable differences and three definite differences. So while it is very close to B. subcaerulescens, it is closer to B. pinophilus.

Maybe time to…
By: Dave W (Dave W)
2015-12-22 12:57:40 GMT (+0000)

re-re-think the non-staining “subcaerulescens” type(s). Has material IDed as subcaerulescens been sequenced?

ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2015-12-22 12:43:00 GMT (+0000)

There is one questionable base pair difference and one solid difference from the European Boletus pinophilus.

AGGGAGGGAAAATGGACAAGGACTCTCAAGGCTGTCGCCGGCAACGTGCACGCCTTCCTCTTTCATGGACYCCCCCTTTCTAGTTTCCTTATCCACCTGTGCACCCTTTGTAGGCCCTCGAAAGAGGTTCTATGTTTATCTATCTACTACCACATGTATGTCCAGAATGTATACAAATTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATCGAATTCTCAACCRTGTCTTGAATGAGGCATGGCTTGGACTTGGGGGTTGCTGGCACACGTCTGTCAGCTCTCCTGAAATGCATTAGCGATGGTCAGCAAGCCTGACGTGCACGGCCTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGGTAGGGTGAGCGGTGAATCGCTTCTAATCTAAAGTCGGTCGTGAGACTGACTGAGGCTAGCCTT

Reminds me of…
By: Dave W (Dave W)
2015-11-11 03:24:38 GMT (+0000)

B. subcaerulescens. I have seen examples that exhibit no blue staining at all. A pine associate.

Created: 2015-11-11 03:15:03 GMT (+0000)
Last modified: 2016-01-15 05:24:05 GMT (+0000)
Viewed: 196 times, last viewed: 2016-11-22 15:13:53 GMT (+0000)
Show Log