Observation 223456: Laccaria nobilis A.H. Sm.
When: 2015-11-14
(17.3124° -96.4407° 2172m)

Notes: Under mixed woods, lots of oak. Unusually large size.

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-12 04:52:02 CDT (-0400)

This sequence is a consensus of the ITS1 and ITS4 read.

TTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGCTGTTAGCTGGCTTTTCAAAGCATGTGCTCGTCTGTCATCTTTATCTCTCCACCTGTGCACATTTTGTAGTCTTGGATACCTATCGAGGCAACTCGGACTTTTAGGATCGCCGTGCTGTACAAGTCGGCTTTCCTTTCATTTCCAAGACTATGTTTTTATATACACCAAAGTATGATTAAAGAATGTTATCAATAGGAAATTGTTTCCTATAAAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCAGCTTTTTATTGGCTTGGTTAGGCTTGGATGTGGGGGTTGCAGGCTTCATAAATGAGGTCAGCTCTCCTTAAATGCATTAGCGGAACTTTTGTAGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTAATGCAGCTTTTTGAAGTTCAGCTTCTAACCGTCCATTATTGACTTGGACAATTTTGACAATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTATTATCCGCGCTGGACCGTGTAC

Created: 2015-11-20 21:37:28 CST (-0500)
Last modified: 2016-03-08 12:13:13 CST (-0500)
Viewed: 26 times, last viewed: 2017-06-21 05:26:42 CDT (-0400)
Show Log