Observation 223456: Laccaria nobilis A.H. Sm.

Notes:
Under mixed woods, lots of oak. Unusually large size.

Species Lists

Images

577358
DSC_1476.JPG
577359
DSC_1479.JPG
577360
DSC_1483.JPG

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-12 10:52:02 CEST (+0200)

This sequence is a consensus of the ITS1 and ITS4 read.

TTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGCTGTTAGCTGGCTTTTCAAAGCATGTGCTCGTCTGTCATCTTTATCTCTCCACCTGTGCACATTTTGTAGTCTTGGATACCTATCGAGGCAACTCGGACTTTTAGGATCGCCGTGCTGTACAAGTCGGCTTTCCTTTCATTTCCAAGACTATGTTTTTATATACACCAAAGTATGATTAAAGAATGTTATCAATAGGAAATTGTTTCCTATAAAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCAGCTTTTTATTGGCTTGGTTAGGCTTGGATGTGGGGGTTGCAGGCTTCATAAATGAGGTCAGCTCTCCTTAAATGCATTAGCGGAACTTTTGTAGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTAATGCAGCTTTTTGAAGTTCAGCTTCTAACCGTCCATTATTGACTTGGACAATTTTGACAATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTATTATCCGCGCTGGACCGTGTAC

Created: 2015-11-21 03:37:28 CET (+0100)
Last modified: 2018-03-09 05:08:06 CET (+0100)
Viewed: 42 times, last viewed: 2018-03-10 15:49:48 CET (+0100)
Show Log