Observation 223456: Laccaria nobilis A.H. Sm.
When: 2015-11-14
(17.3124° -96.4407° 2172m)

Notes: Under mixed woods, lots of oak. Unusually large size.

Proposed Names

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-06-12 01:52:02 PDT (-0700)

This sequence is a consensus of the ITS1 and ITS4 read.

TTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAACCTGATGTGGCTGTTAGCTGGCTTTTCAAAGCATGTGCTCGTCTGTCATCTTTATCTCTCCACCTGTGCACATTTTGTAGTCTTGGATACCTATCGAGGCAACTCGGACTTTTAGGATCGCCGTGCTGTACAAGTCGGCTTTCCTTTCATTTCCAAGACTATGTTTTTATATACACCAAAGTATGATTAAAGAATGTTATCAATAGGAAATTGTTTCCTATAAAAATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTTCCAGCTTTTTATTGGCTTGGTTAGGCTTGGATGTGGGGGTTGCAGGCTTCATAAATGAGGTCAGCTCTCCTTAAATGCATTAGCGGAACTTTTGTAGACCGTCTATTGGTGTGATAATTATCTACGCCGTGGATGTAATGCAGCTTTTTGAAGTTCAGCTTCTAACCGTCCATTATTGACTTGGACAATTTTGACAATTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAGAGCTCAAATTTAAAATCTGGCAGTCTTTGGCTGTCCGAGTTGTAATCTAGAGAAGTATTATCCGCGCTGGACCGTGTAC

Created: 2015-11-20 18:37:28 PST (-0800)
Last modified: 2016-03-08 09:13:13 PST (-0800)
Viewed: 25 times, last viewed: 2017-02-18 23:48:30 PST (-0800)
Show Log