Observation 223599: Boletus edulis group
When: 2015-11-14
(17.313° -96.4404° 2149m)

Notes: Under pine. Not staining blue.

Images

577768
DSC_1585_modified.JPG
577769
DSC_1594.JPG
577770
DSC_1598.JPG
577821
DSC_1611.JPG
577822
DSC_1612.JPG
583838
DSC_1646.JPG
With KOH
583839
DSC_1647.JPG

Proposed Names

87% (1)
Eye3 Eyes3
Recognized by sight
58% (1)
Based on chemical features: 506 out of 509 base pairs in the ITS region match. This is probably a little different, as a closer match is found in the Mexican state of Guerrero (509 out of 510).

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Now in GenBank
By: Alan Rockefeller (Alan Rockefeller)
2016-03-30 07:12:11 CDT (-0400)
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2015-12-23 04:42:36 CST (-0500)

GGGTTTCCTCGGACTCCCCTTCCTAGTTTTCCTTATTTCACCTGTGCACCCTTTGTAGGCCCTCGAGAGAGGATCTACGTTTTCTATAATCTACTCTATCGCATGTCCAGAACGTATACATACAAACTTTTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAATTGCGATAAGTAATGTGAATTGCAGATTTTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACCATGTCTCGATCTGATCTTCTGATCTCGAGGCATGGCTTGGACTTGGGAGTTGCTGGCGGGCCTCGTCAGCTCTCCTCAAACACATTAGCGACGTTCAGCAAGCCTGGCGTGCACGGCCTTTTTTCGACGTGATAACGATCGTCGTGGGCTGGAGCGTAGGGCGAGCGGTGAATCGCTTCCAACTCCTTAGACTTTTGGTCCTTCATC

Created: 2015-11-22 03:16:32 CST (-0500)
Last modified: 2016-03-08 12:44:54 CST (-0500)
Viewed: 68 times, last viewed: 2017-02-19 02:48:05 CST (-0500)
Show Log