Observation 29302: Psilocybe allenii Borov., Rockefeller & P.G. Werner

When: 2009-11-30

Collection location: Sunnyvale, California, USA [Click for map]

Who: Alan Rockefeller (Alan Rockefeller)

No specimen available

Notes:
Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAGGTT

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2009-12-01 00:25:22 EST (-0500)
Last modified: 2018-01-30 21:50:23 EST (-0500)
Viewed: 486 times, last viewed: 2018-04-09 14:07:24 EDT (-0400)
Show Log