Observation 29302: Psilocybe allenii Borov., Rockefeller & P.G. Werner
When: 2009-11-30
No herbarium specimen

Notes: Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAGGTT

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2009-12-01 08:25:22 MSK (+0300)
Last modified: 2012-12-10 14:52:00 MSK (+0400)
Viewed: 421 times, last viewed: 2016-12-03 03:47:23 MSK (+0300)
Show Log