Observation 29302: Psilocybe allenii Borov., Rockefeller & P.G. Werner
When: 2009-11-30
No herbarium specimen

Notes: Sequence: AGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAACTTTGGCGTGGTTGTAGCTGGTC
CTCTCGGGGGCATGTGCTCGCCCGTCATCTTTATATCTCCACCTGTGCACCTTTTGTAGACGTTGGAACTGGATAGGAGAGG
GACTTGTCCTTCAAGTTGAAGGTT

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
No one has commented yet.

Created: 2009-12-01 06:25:22 CET (+0100)
Last modified: 2012-12-10 11:52:00 CET (+0100)
Viewed: 430 times, last viewed: 2017-01-08 05:33:10 CET (+0100)
Show Log