Observation 32768: Amanita stirps Muscaria

Proposed Names

73% (3)
Eye3
Recognized by sight: another example of the “aprica-like” amanita. yellow-orange cap, exannulate, warts easily removed, close cup of a volva. the specimens here that grow in moss beds are always small. this is just up stream from Canyon sightings, but with poorer soils.
-63% (2)
Recognized by sight
2% (2)
Recognized by sight
76% (2)
Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
thanks Rob!
By: Debbie Viess (amanitarita)
2015-07-10 15:57:46 PDT (-0700)

One more step on the road to understanding NA amanitas.

ITS DNA on GenBank
By: Rob Powers (robpowers)
2015-07-10 15:41:45 PDT (-0700)

I submitted the ITS DNA sequence for this collection to GenBank under accession KR338837 (https://www.ncbi.nlm.nih.gov/nuccore/KR338837).

The voucher at the MICH herbarium can be found on mycoportal.org at:
http://mycoportal.org/...

Blast sequence
By: Erlon (Herbert Baker)
2014-06-14 13:35:25 PDT (-0700)

Came back with 98% indent against Amanita “sp-LG1045”. This appears to be close but not the same species.

sequence data
By: Debbie Viess (amanitarita)
2014-05-11 13:14:12 PDT (-0700)

>DLVAM04-ITS1F-ITS4
AGGATCATTATTGAAAGAAACCTCAGGCAGGGGGAAGAGGTGGTTGTAGC
TGGCCTCTAGGGGCATGTGCACACACTGTTGTCTCTCTTGCTTGTTTCTT
CATTCTCTCCACTTGTGCACTGCTTGTAGGCAGCTCTGGCATTGTTCAGG
TTGTCTATGATTTTCTTTAAATACATGAACAATTGTTGTACAGAATGTTA
TAAGAATGAATAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCACG
ATCAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCANT
GAATCATCAATCTTTGAACGCTTCTTGCGCTCCTTGGTATTCCGAGGAGC
ATGCCTGTTTGAGTGTCATTAAATTCTGTCAAAACATTCACTTGAGTGTG
TTTTGGATTGTGGGAGTGTCTGCTGGCTTTATGAGCCACCTCTCCTGAAA
GACATTAGCTTTGGGGGGGGGAGGCAAAAGGCNACTTTGACCTTCCACTG
GGGGGAAAAAATAATTTACCTTTTCCCCCCAAGGAAAGG

Cool
By: Erlon (Herbert Baker)
2014-05-11 12:28:00 PDT (-0700)

Do you have the accession number so I can run my own blast sequence? There are also two other species from Santa Cruz island in stirps Muscaria. Yes, I am aware of the paper by Tulloss and Geml. It was good factor in my interest in this group.

Blue skies, Erlon

my mistake …
By: Debbie Viess (amanitarita)
2014-05-11 09:43:00 PDT (-0700)

this IS the exact fb that was DNA run, but it is representative of all of the distinctively macro-morph collections from both Huck and Canyon.

Here is what Rob had to say about it, after he did some analysis:

“DLVAM04 has strong support (84%) of being distinct from A. muscaria var. regalis and A.muscaria, but seems certain to be within the general muscaria clade. It doesn’t appear to be closely related to A. aprica but you could certainly search GenBank for aprica ITS sequences and add them in to see how far apart they are. I didn’t include the two top hits for DLVAM04 but looking at the accession #s on GenBank for the top 2 hits Rod Tulloss et al. call this "Amanita sp. sp-LG1045’’ and even have a taxon page for it at http://www.ncbi.nlm.nih.gov/... along with a publication “Evidence for strong inter- and intracontinental phylogeographic structure in Amanita muscaria, a wind-dispersed ectomycorrhizal basidiomycete.” If you can’t access the journal article let me know and I can send it to you. Definitely interesting."

So, these are similar to Rod’s Channel Isle amanitas, but not necessarily the exact same sp., definitely within the muscaria clade and definitely NOT aprica!

I am still wrapping my brain around all of these DNA concepts and what they actually mean, and how much user influence has on the outcomes. When one has to manipulate data to get it to “fit,” then human bias can be brought into the mix.

Still, DNA does seem to work very well to show general relatedness.

Hi Debbie
By: Erlon (Herbert Baker)
2014-05-11 09:16:48 PDT (-0700)

Thank you for clarifying. I appreciate it. Very interesting turn of events with this group eh?

no …
By: Debbie Viess (amanitarita)
2014-05-11 09:11:33 PDT (-0700)

but this is an easy and unique species to recognize in hand, from the same area where the DNA determined fb was run.

Dna
By: Erlon (Herbert Baker)
2014-05-11 08:27:04 PDT (-0700)

was dna extracted from this specimen also?

DNA determined …
By: Debbie Viess (amanitarita)
2014-05-07 10:18:40 PDT (-0700)

to be in the muscaroid clade.

So small…
By: Matt Sherman (Shermanii)
2011-01-20 09:48:49 PST (-0800)

How cute!

Created: 2010-01-26 15:43:41 PST (-0800)
Last modified: 2015-07-14 14:34:11 PDT (-0700)
Viewed: 191 times, last viewed: 2016-11-27 15:49:02 PST (-0800)
Show Log