Observation 45561: Amanita muscaria var. guessowii Veselý
When: 2010-05-18
No herbarium specimen

Notes: Pileus – Cream colored, convex, orbicular (ovoid), bicolorous, margin entire, surface dull, dry, covered with scales/warts which are raised but not pointed, smell is not distinctive, there is no latex, lamella apparently adnexed, crowded, narrow, smooth. The pileus surface bruises orange/red.
Stipe – Central, inserted, clavate, rugose at the base but not at middle or apex, white colored at middle and apex but brown at base, solid, bruises yellow at top (only), consistency is cartilaginous (breaks with firm split), does not have veil, volva or anulus (stature pluteotoid).

Because it was found on grass, it has gills, no volva or universal veil remnants and it has a clavate stipe that bruises orange/red it suggests it could be Leucoagaricus americanus. Unfortunately I did not manage to get a spore print.

More details on http://mushroompicker.blogspot.com/...

[admin – Sat Aug 14 02:05:19 +0000 2010]: Changed location name from ‘Rockville, Maryland’ to ‘Rockville, Maryland, USA

Proposed Names

-93% (3)
Used references: Orson et al (2006). North American Mushrooms: A Field Guide to Edible and Inedible Fungi.
31% (3)
Recognized by sight: Colarlike stipe,Universal Veil Pileus Remnants
-1% (2)
Eye3
Based on chemical features: Intergenic region 1 (ITS1) was sequenced. Sequence obtained was: gccagggctgcctacaagcagtgcacaagtggagagaatgaagaaacaagcaagagagacaacgg
This has 100% match with A. muscaria.

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Interesting..
By: Erlon (Herbert Baker)
2010-05-25 12:48:54 PDT (-0700)

I wish they would put where the specimen was from, its an important thing to know when using DNA evidence. A picture of the fungi would be excellent also.
We can only guess their specimen is collected from Japan, then your specimen would likely be a transplant to north America.

DNA evidence
By: Michael Waisberg (waisberg)
2010-05-25 10:58:43 PDT (-0700)

I queried against the nr. Best match was 100% similarity with A muscaria, which doesn’t mean that it could not be amerimuscaria. It is just that the deposited sequence ( http://www.ncbi.nlm.nih.gov/... ) is annotated as being A muscaria (it could have been misannotated). The sequence was deposited by Oda,T., Tanaka,C. and Tsuda,M.Molecular phylogeny and biogeography of the widely distributed Amanita species, A. muscaria and A. pantherina.

DNA
By: Erlon (Herbert Baker)
2010-05-25 10:07:24 PDT (-0700)

Was that compared with A. amerimuscaria or A. muscaria?

Amanita species
By: AmatoxinApocalypse (AmatoxinApocalypse)
2010-05-18 12:02:54 PDT (-0700)

Definitely an Amanita species, maybe in section Amanita?

http://www.eticomm.net/~ret/amanita/sectaman.html

Created: 2010-05-18 05:18:16 PDT (-0700)
Last modified: 2013-11-17 01:26:02 PST (-0800)
Viewed: 147 times, last viewed: 2016-08-15 14:54:07 PDT (-0700)
Show Log