Observation 50125: Macowanites Kalchbr.
When: 2010-08-10
Herbarium specimen reported

Notes: Under monterey pine in grass.
Mild taste, no odor.
DD659 – Sent to Dr. Mike Davis at UC Davis.

Proposed Names

61% (2)
Eye3 Eyes3
Recognized by sight

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
Hey Curecat
By: Christian (Christian Schwarz)
2010-08-21 01:47:03 CDT (-0400)

I just blasted that sequence and I also got R. pectinatoides (along with R. amoenolens and Gymnomyces fallaxBUT
My hit to pectinatoides had a max identity of 95%, and an E value of 0.00… not bad for 642 bp…
What makes you say it’s pretty far off? I know how to use the tools, but not necessarily how to interpret them.

Thanks Darv
By: Erin Page Blanchard (CureCat)
2010-08-21 01:42:40 CDT (-0400)

So the closest match in genbank is Russula pectinatoides, but even that is pretty far off… There is a single (distant) match for Macowanites ammophilus, but the ITS is only 91% identical.

ITS sequence by Dr. Mike Davis
By: Darvin DeShazer (darv)
2010-08-20 22:53:39 CDT (-0400)

R10001 936 Macowanites sp Darvin DeShazer
aaggatcattattgtacaatagaggtgctggggttgtcgctgacttttgaaatggtcgtgcacacctcggtgct-ctcacatacaatccatctcacccctcttgtgcatcaccgcgtggaggccccttttggctagttctaaggggggt-tttcacgt
ttttatacatacaccattttaatgcaatgygtagaatgtcatacttttgcggtcacacgcaattaatacaactt-tcaacaacggatctcttggctctcgcatcgatgaagaacgcagcgaaatgcgatacgtaatgtgaattgcagaa-ttcagtgaatcatcgaatctttgaacgcaccttgcgccctttggtattccgaagggcacacccgtttgagtgtc-gtgacatcctcaaaccttcttggtttatttcttgaccaagaaggctttggactctggaggttcttgctggcctt-actttgttgaagccagctcctctgaaatgaattagtgggatctgctttgcggatccttgacgtgataagatatt-tctacgtcttggatcttgcactgtttcgctctggatcctgcttctaaccgtcttatagaagacaatgggtcaag-tgatcgccacttggcccacaaaccttga

Just saw your original comment of no odor.
By: Daniel B. Wheeler (Tuberale)
2010-08-15 11:04:44 CDT (-0400)

Duh. Right when I hit the create button. Sorry.

Any odor?
By: Daniel B. Wheeler (Tuberale)
2010-08-15 11:03:59 CDT (-0400)

At least some of the Macowanites can be separated by smell alone.

Buried
By: Darvin DeShazer (darv)
2010-08-14 23:06:24 CDT (-0400)

This collection was half buried showing only the top of the cap. The grass covered the top and made it almost impossible to see unless you stood directly above it. It was taken fresh to UC Davis for DNA work.

Most of the
By: Christian (Christian Schwarz)
2010-08-14 22:39:08 CDT (-0400)

Macowanites I find in Santa Cruz are aboveground.

Found mostly hypogeous?
By: Daniel B. Wheeler (Tuberale)
2010-08-14 21:43:58 CDT (-0400)

Another characteristic for Macowanites, as it no longer needs much stipe. Or is this in the transitional phase between Russula and Macowanites? I do wish someone would sort this bunch out.

Created: 2010-08-10 19:48:17 CDT (-0400)
Last modified: 2010-08-12 10:55:17 CDT (-0400)
Viewed: 130 times, last viewed: 2016-06-19 16:30:18 CDT (-0400)
Show Log