Observation 57949: Melanoleuca exscissa (Fr.) Singer
When: 2010-11-03

Notes: Pleurocystidia not observed. Cheilocystidia harpoon shaped with encrustations. Spores with amyloid warts.

Images

118339
118334
118335
118336
118337
118338
118340
118385
pileipellis, gills
118386
cheilocystidia not abundant, very sharp, sticks out far from the gill.
118387
cheilocystidia not abundant, very sharp, sticks out far from the gill.
118388
pileipellis made from interwoven hyphae
118398
cheilocystidia in melzers
118399
cheilocystidia in melzers
118400
spores in melzers
118401
spores in melzers

Proposed Names

63% (5)
Based on microscopic features: urticoid cystidia
-76% (3)
Recognized by sight: White, in grass, close gill spacing
Used references: mushroomexpert
Based on microscopic features: Encrusted harpoon shaped cystidia, spores with amyloid warts.
31% (2)
Recognized by sight: Medium sized, cap slightly darker in the center, low broad umbo, dry cap, small bulb at the base of the stem.
Based on microscopic features: Cystidia present.
29% (1)
Used references: Christian Schwarz

Please login to propose your own names and vote on existing names.

Eye3 = Observer’s choice
Eyes3 = Current consensus

Comments

Add Comment
ITS sequence
By: Alan Rockefeller (Alan Rockefeller)
2016-04-15 15:38:30 CDT (-0500)

CGGTAGATTGTTGCTGGTTCTTAGGAGCATGTGCACATCTGCCATTGTTTCATTCTTTCTCCACCT
GTGCACCTTTTGTAGGCTTGAATATAACTCTCAAGAATTGAATTACATTTAGTTCTTGGATTTAAGGATTGGTTTCCAGA
AAACTCTCCTTTGTATTTCCAGCCTATGTTTTTATCAATTTACACCCCACTAGTATGTCTTAGAATGTTTATTATTTGGC
CTTTCTTTTGATCGGCTTTAAAACTTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCG
AAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCG
AGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCCTTTCTGGGTTTATTCTCAGCTAGGGTTGGATATGGGGGTTT
TGCCGGTTTTGCAAAAGCAAAGTCAGCTCTCCTGAAAGTCATTAGCAAGACTCTTGTTGCAACTGTCTATCTGGTGTGAT
AATTATCTACATCATAGATTGTATGCAGTTTACTATGTCTAGCTTCTAACAGTCCATTGAATTGGACAAAACTCTGACAA
TTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAT

Dusty-looking light gray cap
By: Christian (Christian Schwarz)
2015-11-30 10:34:47 CST (-0600)

reminds me of M. subpulverulenta

Melanoleuca…
By: Douglas Smith (douglas)
2010-11-04 07:03:59 CDT (-0500)

Melanoleuca melaleuca at least in specific European description does not have cystidia, so that is out. I think in Mushroom Expert, he was putting this name in quotes to point out that Melanoleuca is not well studied in the US, and you can basically just dump things into that name. But I think white guys like this not really, and certainly not, if you actually go through the effort of showing the cystidia…

It doesn’t look like there is a European name to apply to this, although I didn’t look too hard. Given how well studied Cali. Melanoleuca is, it is probably a non-described species. Although I’ve seen white Melanoleuca in Cali. in the past, so it isn’t that uncommon, perhaps.

Created: 2010-11-04 04:04:30 CDT (-0500)
Last modified: 2016-04-15 15:36:27 CDT (-0500)
Viewed: 142 times, last viewed: 2016-11-30 16:52:45 CST (-0600)
Show Log